ID: 1017294373

View in Genome Browser
Species Human (GRCh38)
Location 6:152776920-152776942
Sequence ACATTTATGAAGAATTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017294367_1017294373 -3 Left 1017294367 6:152776900-152776922 CCCCTGCTGCAGTGCCTATGACA No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data
1017294368_1017294373 -4 Left 1017294368 6:152776901-152776923 CCCTGCTGCAGTGCCTATGACAT No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data
1017294366_1017294373 -2 Left 1017294366 6:152776899-152776921 CCCCCTGCTGCAGTGCCTATGAC No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data
1017294369_1017294373 -5 Left 1017294369 6:152776902-152776924 CCTGCTGCAGTGCCTATGACATT No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data
1017294364_1017294373 25 Left 1017294364 6:152776872-152776894 CCCACTGGGGTGCTGGTGGGCAG No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data
1017294365_1017294373 24 Left 1017294365 6:152776873-152776895 CCACTGGGGTGCTGGTGGGCAGA No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017294373 Original CRISPR ACATTTATGAAGAATTTGGA GGG Intergenic
No off target data available for this crispr