ID: 1017296861

View in Genome Browser
Species Human (GRCh38)
Location 6:152807587-152807609
Sequence GAATATGAAAAGATGCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017296859_1017296861 -8 Left 1017296859 6:152807572-152807594 CCACAAAGAGTTGTTGAATATGA No data
Right 1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017296861 Original CRISPR GAATATGAAAAGATGCAGAT GGG Intergenic
No off target data available for this crispr