ID: 1017296887

View in Genome Browser
Species Human (GRCh38)
Location 6:152807937-152807959
Sequence CTGGAAATGAAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017296887_1017296893 18 Left 1017296887 6:152807937-152807959 CCTTCCTCCATTTTCATTTCCAG No data
Right 1017296893 6:152807978-152808000 CGTTGGTGAGATGTAGTGATAGG No data
1017296887_1017296894 21 Left 1017296887 6:152807937-152807959 CCTTCCTCCATTTTCATTTCCAG No data
Right 1017296894 6:152807981-152808003 TGGTGAGATGTAGTGATAGGAGG No data
1017296887_1017296892 1 Left 1017296887 6:152807937-152807959 CCTTCCTCCATTTTCATTTCCAG No data
Right 1017296892 6:152807961-152807983 TTAAAACATGGAGAAATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017296887 Original CRISPR CTGGAAATGAAAATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr