ID: 1017307822

View in Genome Browser
Species Human (GRCh38)
Location 6:152939710-152939732
Sequence ATAAATTAGCAACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017307820_1017307822 20 Left 1017307820 6:152939667-152939689 CCACAATGCTCGGTACAAAGATA No data
Right 1017307822 6:152939710-152939732 ATAAATTAGCAACTGTTGCCAGG No data
1017307818_1017307822 30 Left 1017307818 6:152939657-152939679 CCAGTGTCTACCACAATGCTCGG No data
Right 1017307822 6:152939710-152939732 ATAAATTAGCAACTGTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017307822 Original CRISPR ATAAATTAGCAACTGTTGCC AGG Intergenic
No off target data available for this crispr