ID: 1017312379

View in Genome Browser
Species Human (GRCh38)
Location 6:152988818-152988840
Sequence AGTCTAACAAGTCCAAAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 2, 1: 1, 2: 1, 3: 8, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017312379_1017312382 22 Left 1017312379 6:152988818-152988840 CCAGCTTTTGGACTTGTTAGACT 0: 2
1: 1
2: 1
3: 8
4: 141
Right 1017312382 6:152988863-152988885 TCCTTTTAAGGAAGTTTGTCTGG 0: 2
1: 0
2: 2
3: 25
4: 155
1017312379_1017312380 10 Left 1017312379 6:152988818-152988840 CCAGCTTTTGGACTTGTTAGACT 0: 2
1: 1
2: 1
3: 8
4: 141
Right 1017312380 6:152988851-152988873 AACACAAGCCAATCCTTTTAAGG 0: 2
1: 0
2: 0
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017312379 Original CRISPR AGTCTAACAAGTCCAAAAGC TGG (reversed) Exonic
902517882 1:16999569-16999591 AGGTTAGCAAGTCCTAAAGCTGG + Intronic
902768355 1:18631412-18631434 AGTCAAACGCGTCCAGAAGCTGG - Exonic
905556902 1:38893184-38893206 AGTCTGAAAATTCCAAAGGCAGG + Exonic
909597881 1:77427196-77427218 AAACTAACAAAACCAAAAGCTGG + Intronic
910047018 1:82929994-82930016 AGTTTGACAAGTTCAAAAGCAGG - Intergenic
916979802 1:170121751-170121773 AGACTGGCAAGTCCAAAATCTGG - Intergenic
918212227 1:182361388-182361410 AGTTTAAGGAGTCCAAAATCTGG + Intergenic
918495819 1:185134481-185134503 AGTTTAAAAAGTCAAATAGCTGG - Intronic
918716480 1:187793583-187793605 AGTCTAACAAATCCAGAAATTGG + Intergenic
918906682 1:190505474-190505496 AGGCTGACAATTCCAAAAACCGG - Intergenic
918935819 1:190919478-190919500 AGTCTAACAATACTAAAAGAGGG + Intergenic
922852320 1:228743655-228743677 AGCCAAAGAAGTCTAAAAGCAGG + Exonic
923288997 1:232526272-232526294 AGTCTAACTCCTCAAAAAGCAGG + Intronic
924372477 1:243367211-243367233 AATCTAAAAAGTATAAAAGCTGG - Intronic
1063819805 10:9820718-9820740 ACTCTGACAATTCCAGAAGCCGG + Intergenic
1064814824 10:19248232-19248254 AATCTAACAGTTTCAAAAGCAGG + Intronic
1065347211 10:24760006-24760028 AGGCTGACAAGTCCCAAAGTTGG - Intergenic
1067079258 10:43204142-43204164 AGTCTACCCTGTCCACAAGCAGG - Intronic
1068971696 10:62964803-62964825 AGTTTAAAAAGTTCCAAAGCTGG - Intergenic
1069168901 10:65200271-65200293 AGTCTCAAAACTTCAAAAGCAGG - Intergenic
1070068804 10:73065581-73065603 AGTCTGACAAAACCAAGAGCTGG + Intronic
1072173917 10:92896854-92896876 ATTCTCACAAGTCAAAAAACAGG - Intronic
1072749669 10:97968677-97968699 TTTCTAACATGTCCTAAAGCTGG - Intronic
1073912841 10:108366984-108367006 AGTCTAAAAAGTCCAAGTGTTGG + Intergenic
1074730936 10:116374648-116374670 TATTTAAAAAGTCCAAAAGCAGG + Intronic
1081356495 11:42120760-42120782 GGTCTAACAATTTCAAAAGTTGG - Intergenic
1081647659 11:44800965-44800987 AGTCTGACAAGGGCAGAAGCAGG + Intronic
1086903766 11:92396295-92396317 AGTGTAACTAGTCCCAAACCAGG + Intronic
1093010303 12:14100505-14100527 AGGCTGACAAGTCCAAGATCAGG + Intergenic
1095763863 12:45872065-45872087 AATTTAACAAAACCAAAAGCTGG - Intronic
1095774291 12:45995106-45995128 AGGCTAACAAGTCCCACAACAGG - Intergenic
1095796642 12:46226529-46226551 AGTCTAGAAGGTCCAAAATCTGG + Intronic
1098587558 12:72171863-72171885 AGTCTCACAAATTCAACAGCTGG - Intronic
1101346328 12:103889542-103889564 AGCCCAGCATGTCCAAAAGCTGG + Intergenic
1103952712 12:124559710-124559732 AGACAAACAAATCCAAAATCAGG + Intronic
1104536141 12:129620117-129620139 ATCCTTTCAAGTCCAAAAGCAGG + Intronic
1111234982 13:85398170-85398192 ATTCAAAAAAGTCAAAAAGCAGG - Intergenic
1113225006 13:108149934-108149956 AGCCTAACAAGTCTAATATCCGG + Intergenic
1115311885 14:31987004-31987026 AGTCTAATAATTCCAACATCTGG + Intergenic
1116539427 14:46080659-46080681 AGTCTAACAATACCAAATGTTGG - Intergenic
1117492605 14:56265930-56265952 AGACTGACAATTCCAAAAGTTGG + Intronic
1117925152 14:60771209-60771231 AGTCTGACAATACCAAATGCTGG - Intronic
1119257954 14:73215785-73215807 AGGCTAACAATACCAAGAGCTGG + Intronic
1123569673 15:21591307-21591329 ATTCTAAAAAGTCCAGGAGCTGG - Intergenic
1123605783 15:22026626-22026648 ATTCTAAAAAGTCCAGGAGCTGG - Intergenic
1125299793 15:38242673-38242695 AGTCTAAAAAGAGCAAAACCAGG + Intergenic
1130544460 15:84844446-84844468 TGTCTAATAATTCCAAAAGTTGG - Intronic
1130734903 15:86537810-86537832 AGTATAAGAAGTCCTAAAGGAGG - Intronic
1202978024 15_KI270727v1_random:318398-318420 ATTCTAAAAAGTCCAGGAGCTGG - Intergenic
1133934351 16:10256744-10256766 AGTGTACCCAGTGCAAAAGCTGG + Intergenic
1141528597 16:84629715-84629737 GGTCTAACAAGCCCTATAGCGGG + Intergenic
1148788388 17:50158120-50158142 AGTCTAACAAGAGCAAAAGTTGG - Intergenic
1150520410 17:65861729-65861751 AGTCTGACAATACCAAATGCTGG + Intronic
1150835205 17:68557561-68557583 AGGCTAAGAAGTCCAATACCAGG - Intronic
1151651904 17:75475433-75475455 AGCCTAACAGGTCCCAGAGCTGG - Intronic
1153104769 18:1513767-1513789 AGTCCAACTATGCCAAAAGCAGG + Intergenic
1153324685 18:3806369-3806391 AGTCTAAGAATGGCAAAAGCAGG - Intronic
1156224269 18:35087867-35087889 AGGCTAAGAAGTCCAAGATCAGG + Intronic
1158494948 18:57946639-57946661 AGGCTAGGAAGTCCAAAACCAGG + Intergenic
1159219622 18:65442337-65442359 AGACTAGCAATTCCAAAAGAGGG - Intergenic
1159866871 18:73716197-73716219 AGTCTAGGAAGTCCAAGACCAGG + Intergenic
1165084840 19:33337135-33337157 AGTCTGAGAAGTCCAAACTCAGG - Intergenic
1167288229 19:48610787-48610809 CATCCACCAAGTCCAAAAGCAGG + Exonic
925992887 2:9268092-9268114 AGTATAAAAAGTTCAAAAACAGG - Intronic
927752648 2:25683500-25683522 AGTTTCACAATTCCAAATGCTGG + Intergenic
932011919 2:67987141-67987163 ATCCTAGCAAGACCAAAAGCTGG - Intergenic
937684493 2:124680553-124680575 TGTATACCAAGTCCAAAATCTGG + Intronic
940105746 2:150097973-150097995 ACTCAAACAAGTCCAAATTCAGG + Intergenic
941233093 2:162936091-162936113 AACCTAACAATTCCAAAAGTTGG + Intergenic
942441681 2:176043401-176043423 AGTCTAATAATTCCAATACCTGG - Intergenic
942681573 2:178482018-178482040 ATTCTAATAAATCAAAAAGCAGG - Intronic
942913005 2:181268950-181268972 AGTCCAACAAGTCCAAAGGCAGG + Intergenic
942991769 2:182210294-182210316 ACACTAACAACACCAAAAGCTGG - Intronic
944184576 2:196932738-196932760 AGGCTAGGAAGTCCAAGAGCTGG - Intergenic
946715246 2:222547456-222547478 AATCTAACAAGTCCAAACAGAGG - Intronic
946717657 2:222569677-222569699 AGTCTAAAAAAGTCAAAAGCAGG - Intergenic
1169809184 20:9592167-9592189 ACTCTAAGAACTCTAAAAGCAGG + Intronic
1170440996 20:16378585-16378607 AGGCTAACAATTCTAAAAGAAGG + Intronic
1171134705 20:22685844-22685866 AGTCTTGCATGTCTAAAAGCTGG - Intergenic
1174090805 20:48045466-48045488 AGTCTAACAAGTCCATGTGGGGG + Intergenic
1179679513 21:43008917-43008939 AGCCTATCATGGCCAAAAGCTGG + Intronic
951543385 3:23804484-23804506 AGAATAAGAAGTTCAAAAGCTGG - Intergenic
953888216 3:46731594-46731616 AGTCTGACAATACCAAACGCTGG + Intronic
955725136 3:61925033-61925055 AGGCTAGGAAGTCCAAAATCAGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959815923 3:110672618-110672640 AGGCTGAAAATTCCAAAAGCCGG + Intergenic
962294230 3:134166345-134166367 AGTCTAGGAAGTCCAAAATTAGG - Intronic
964266654 3:154904615-154904637 AGCCTAACAAGCCCAAAGGAAGG + Intergenic
964891697 3:161544285-161544307 AGTCTCAAAAGTACAAATGCTGG + Intergenic
967671063 3:192235805-192235827 AGATGAACAAGCCCAAAAGCTGG - Intronic
969855737 4:9997933-9997955 ACTCTAACATGTCAAAAAGGAGG + Intronic
971595287 4:28519391-28519413 AGTCTAACAAGCCCCAGAACAGG - Intergenic
971784158 4:31078729-31078751 AATATTACAAGTCCAAAAGTTGG + Intronic
972121402 4:35709177-35709199 AGTCTCAAAACTTCAAAAGCAGG + Intergenic
973805133 4:54518409-54518431 AGGCTGAGAAGTCCAAGAGCAGG - Intergenic
977868319 4:102058002-102058024 ATTATAACAAGTACAAAAGCAGG - Intronic
978836920 4:113161968-113161990 AGGCTAAAAAGTCCAAGAGACGG - Intronic
982257473 4:153465423-153465445 TAACTAACAAGTCCAAAATCTGG - Intergenic
983074844 4:163313556-163313578 AGACTAACAACACCAAATGCTGG - Intergenic
985323476 4:188740549-188740571 AGTCTAACAAGTCCAAAAGCTGG + Intergenic
987148307 5:15013874-15013896 AACCTAACAAATCCAAAACCAGG - Intergenic
987918296 5:24245235-24245257 AGAATAACAAGTTCAGAAGCAGG + Intergenic
988173527 5:27690806-27690828 AGGCTAGAAAGTCCAAAATCAGG + Intergenic
988540657 5:32105889-32105911 TGTGTAAAAAGTCCAAAAGCTGG + Intronic
988678169 5:33456000-33456022 AGTACAACAAGTTCAAATGCCGG + Exonic
991623719 5:68575021-68575043 TGTATAACAAGTCCAACAGCTGG - Intergenic
992610945 5:78508161-78508183 AGCCTAAAAAGTCCAAAGGAAGG + Intronic
994615920 5:102104194-102104216 AGACTGAGAAGTCCAAAATCAGG + Intergenic
999683685 5:154083538-154083560 AGGCTAACAAATCAAAAACCTGG - Intronic
1002128159 5:177062335-177062357 AGTCCAACAGGTCTAAAGGCTGG - Intronic
1002345896 5:178547380-178547402 GGACTATCAAGTCCAAAATCTGG - Intronic
1003196099 6:3916369-3916391 ACTCTAACAACACCAAATGCTGG + Intergenic
1003637495 6:7846295-7846317 AGACTCACAAGACCAAAAGTGGG - Intronic
1008835673 6:55824804-55824826 TGTCTAACAAGACCAAGAGGGGG + Intronic
1010617627 6:78031769-78031791 AGTCCAAAAACTCCAAAAGTAGG + Intergenic
1011396289 6:86912338-86912360 AGGCAAACAAGCTCAAAAGCTGG + Intergenic
1014195406 6:118552389-118552411 TGTCTAGCAAGTCATAAAGCAGG + Intronic
1015917821 6:138235532-138235554 AGAATACCATGTCCAAAAGCAGG - Intronic
1017312379 6:152988818-152988840 AGTCTAACAAGTCCAAAAGCTGG - Exonic
1017461381 6:154654327-154654349 AGTATATTAAGTACAAAAGCAGG + Intergenic
1017582047 6:155876384-155876406 AGAATAAAAAGTCCAAAATCTGG + Intergenic
1018090607 6:160344519-160344541 AGTCTAACAAGACCAAGTGTTGG + Intergenic
1022768781 7:33446469-33446491 ATTATATCAAGTCTAAAAGCAGG + Intronic
1022882464 7:34602205-34602227 AGTCTCACAAGGCTAAAATCAGG - Intergenic
1027633285 7:80635998-80636020 ATTCTAGCAAGTGCAAAGGCAGG + Intronic
1028161733 7:87493537-87493559 ATCCTAACAATTCCAAGAGCAGG + Intergenic
1028864022 7:95687180-95687202 AGTTTAACAACTCCTGAAGCAGG + Intergenic
1031171685 7:118299599-118299621 AGACTAGCAAGTCAAAAAACTGG - Intergenic
1032860733 7:135876721-135876743 AGGCTACGAAGCCCAAAAGCAGG - Intergenic
1034904427 7:154931802-154931824 TGTCTAATAAGTCCAACATCTGG + Intronic
1035036069 7:155895075-155895097 AGCCAAGCTAGTCCAAAAGCTGG + Intergenic
1037800803 8:22034224-22034246 TGTCAAACAAGTCAAAAGGCTGG + Exonic
1038428756 8:27483097-27483119 AGTCTACAAAGTCGAACAGCTGG - Intergenic
1042730834 8:71932461-71932483 AGTCTAACAATACCAAATGTTGG - Intronic
1045178693 8:99756014-99756036 TGTCTAATAAGTCCAACATCTGG - Intronic
1045186556 8:99844235-99844257 AGTCTAGGAAGTCCAACATCAGG + Intronic
1045635195 8:104178156-104178178 AATCTCACAAGGCCAAAATCAGG + Intronic
1046626026 8:116577868-116577890 AGGCTAAGAAGTCCAAGATCAGG + Intergenic
1046901601 8:119529381-119529403 AGTCTTACTAGTCCAAACGTCGG - Intergenic
1047450265 8:124959098-124959120 TTTCTAACAATTCCAAAAGCTGG + Intergenic
1047931354 8:129731514-129731536 AGTCTAACAAGTCCAAAACCTGG + Intergenic
1050485530 9:6130639-6130661 AGACAAACAAGTCCAGAAGCTGG + Intergenic
1052831091 9:33216365-33216387 AGTCTCTCAAGTCCAAAACCTGG + Intergenic
1188192167 X:27184690-27184712 AGTGTCACAAAACCAAAAGCTGG + Intergenic
1188965314 X:36544451-36544473 ATTCTACCAAGTACATAAGCAGG + Intergenic
1191933599 X:66401920-66401942 AGACTAACAAATCCAATAACTGG - Intergenic
1193433113 X:81436830-81436852 AGATTAACAAAACCAAAAGCTGG - Intergenic
1193805066 X:85985212-85985234 AGTCTCCAAAGTCCAAAGGCTGG - Intronic
1194581845 X:95682793-95682815 AGTCAAACAAGGCCAAAATGAGG + Intergenic
1196032312 X:111103781-111103803 AGTCTGACAGGCCCAGAAGCAGG - Intronic
1199365759 X:146980491-146980513 AGGCAAACAAATCCCAAAGCTGG - Intergenic
1201409445 Y:13684104-13684126 AGGCTAGCAATTCCAAAACCTGG + Intergenic
1201961822 Y:19689584-19689606 AGTCTGAAAATTCCAAAAACTGG - Intergenic