ID: 1017313447

View in Genome Browser
Species Human (GRCh38)
Location 6:153001766-153001788
Sequence CGCTGGTGGCTGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313447 Original CRISPR CGCTGGTGGCTGACAGGCCA GGG (reversed) Intronic
900357126 1:2270404-2270426 CGTTGGTCCCTCACAGGCCAGGG + Intronic
900680939 1:3915806-3915828 TCCTGGTGGGTGACAGCCCATGG + Intergenic
902572658 1:17356632-17356654 CCCTGTGGGCTCACAGGCCAGGG + Intronic
902820865 1:18942396-18942418 GGCTGGTGGGAGCCAGGCCAGGG + Intronic
903124699 1:21239669-21239691 GGCTGGGGGCTGACAGGAAAGGG + Intronic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
903684391 1:25120203-25120225 CCCTGGGGGCTGCCTGGCCAGGG + Intergenic
904384990 1:30135228-30135250 GGCTGGAGTCTGACAGGCCAGGG - Intergenic
906154755 1:43607395-43607417 AGCTGGAGGCCCACAGGCCATGG + Intronic
906263068 1:44407584-44407606 CGCTGGTGGCCGACAGGGCCGGG + Intronic
907243760 1:53094513-53094535 CTCTGGTGTCCCACAGGCCAGGG - Intronic
908070628 1:60455597-60455619 CGCTGGTGGAGGATAGGGCAGGG - Intergenic
908538398 1:65100150-65100172 CGCTTGAGCCTGGCAGGCCAAGG + Intergenic
909869573 1:80722698-80722720 GCCTGGAGGCTGACAAGCCAGGG + Intergenic
915891630 1:159779333-159779355 GACTGGTGGCTGAGAGGCCATGG + Intergenic
920085319 1:203411363-203411385 GCCTGGTTCCTGACAGGCCATGG + Intergenic
922724472 1:227915962-227915984 CGCAGGTGGGAGACAGGCCCAGG - Intergenic
922727549 1:227929934-227929956 CTCTGGAGGCTGGAAGGCCAAGG - Intronic
924079056 1:240373271-240373293 AGCTGCTCGCTGACAGGTCAGGG + Intronic
924251697 1:242139719-242139741 TGCTGGAGGCAGACAGGACAGGG + Intronic
924699695 1:246438969-246438991 GCCTGGTTCCTGACAGGCCATGG + Intronic
1065916753 10:30359538-30359560 TGGTGGGGGCTGGCAGGCCACGG - Intronic
1066351584 10:34641799-34641821 AGGTGGTGGCTGACAGACCATGG + Intronic
1067048525 10:42999327-42999349 CGTTGGGGGCTGACAGTGCAAGG - Intergenic
1069062924 10:63913076-63913098 TGATGGTGTCTGACAGGGCATGG + Intergenic
1069898259 10:71692263-71692285 CGGGGGTGGCTAAAAGGCCAGGG - Intronic
1069914927 10:71781590-71781612 CGCTTGTGGCTTAAAGGCCATGG - Intronic
1072256918 10:93629886-93629908 TGCTGGTTCCTAACAGGCCATGG + Intronic
1072619832 10:97072603-97072625 GGCTGTGGGCTGACTGGCCAGGG - Intronic
1073188762 10:101635003-101635025 TCCTGGTTGCTAACAGGCCATGG - Intronic
1074351752 10:112744526-112744548 CGCTTGAGCCTGAGAGGCCAAGG - Intronic
1076251337 10:128986167-128986189 GGCTGATGGCTGGCAGGGCAGGG - Intergenic
1076389381 10:130086954-130086976 CGCAGGGGGCTGAAGGGCCAGGG + Intergenic
1076594554 10:131617722-131617744 CGCGGGTGGCTGCCAAGACACGG - Intergenic
1076793692 10:132788907-132788929 CGCTGGGGGCTGAGGGGCGACGG + Intergenic
1077058163 11:605981-606003 TGCTGGTGGCTCTCAGGCCGGGG - Intronic
1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG + Intronic
1078011600 11:7576710-7576732 GGCTGGTGGCCAACAGTCCAGGG + Intronic
1079322852 11:19466192-19466214 CTGTGTTGGGTGACAGGCCAAGG + Intronic
1081620110 11:44614406-44614428 CTCTGGTGCCTGGCAGACCATGG + Intronic
1087789533 11:102391850-102391872 TGCTGCTGTCTGCCAGGCCAGGG - Intergenic
1088382841 11:109215865-109215887 CCCTAGTGCCTGACAGGCCCTGG + Intergenic
1089691099 11:120187094-120187116 TACTGGTGGGTGACAGGTCAAGG + Intergenic
1090034684 11:123238489-123238511 GGCTGTTGGCTGACATGGCAAGG + Intergenic
1094719816 12:33052502-33052524 GGCTCGAGGCTGACAGGTCAGGG - Intergenic
1094719906 12:33052798-33052820 CGCTGGAGGGTGGCTGGCCAAGG - Intergenic
1096125537 12:49116726-49116748 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1096229911 12:49890980-49891002 CACTGGTGGCTGGCAGGGCTGGG + Intronic
1100567308 12:95809591-95809613 GGCTGGTTCCTAACAGGCCACGG + Intronic
1102351330 12:112194350-112194372 GGCTGGAGGCTGAGATGCCAGGG + Intronic
1103338544 12:120208726-120208748 CGCATGTGGCCCACAGGCCATGG - Intergenic
1103882131 12:124174432-124174454 CGCGGGTAGCTCACACGCCAGGG - Intronic
1103956583 12:124580601-124580623 TGATGGCGGCTGACAGGACAGGG - Intergenic
1103985184 12:124762212-124762234 CACTGGTGGCAGACAAACCAGGG - Intergenic
1104205499 12:126634689-126634711 TGCTGCTTGCTGACATGCCATGG + Intergenic
1104405068 12:128510360-128510382 CCCTGAAGGCTGGCAGGCCAGGG + Intronic
1104950333 12:132437104-132437126 TGCTGGGGGCTGAAAGTCCAAGG + Intergenic
1105571881 13:21610815-21610837 GGCTGGTGGCTGGCAGGGCTGGG + Intergenic
1105805328 13:23948819-23948841 CACTGGTGCCTGGGAGGCCAAGG + Intergenic
1106511786 13:30419377-30419399 CTGTGGTGGCAGACAGGCCTGGG + Intergenic
1109111615 13:58327726-58327748 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1113906782 13:113822973-113822995 CGCTGTTGGGGGACCGGCCAAGG + Intronic
1113945654 13:114042746-114042768 GGCTGCTGGATGCCAGGCCAGGG - Intronic
1114736645 14:25049752-25049774 GGCGGGTGGCTGTGAGGCCAGGG - Intronic
1114924927 14:27384246-27384268 CGCCGGCAGCTGGCAGGCCATGG - Intergenic
1117804638 14:59478997-59479019 TGCATGTGGCTCACAGGCCACGG + Intronic
1118181020 14:63493369-63493391 ATCTAGTGGCAGACAGGCCAGGG - Intronic
1118223176 14:63874460-63874482 CGCAGGAAGATGACAGGCCAAGG + Intronic
1120877654 14:89389654-89389676 ATCTGCTGGCTGGCAGGCCACGG + Intronic
1122184022 14:99975764-99975786 GCCTGGTTCCTGACAGGCCATGG + Intronic
1122898021 14:104769952-104769974 AGCTGGTGACAGACAGCCCAGGG + Exonic
1123022694 14:105409112-105409134 GGCTGGTTGCTGGCAGTCCAGGG - Intronic
1123039780 14:105485771-105485793 GACTGGTGGCAGACAGGGCAGGG + Intergenic
1123585122 15:21753125-21753147 TGCTGGTGCCTGACAGGTCCAGG - Intergenic
1123621769 15:22195732-22195754 TGCTGGTGCCTGACAGGTCCAGG - Intergenic
1123705560 15:22948325-22948347 CGCTGGTGGCTGTCTGGCTGTGG - Intronic
1127063539 15:55213502-55213524 GCCTGGTTGCTAACAGGCCATGG - Intronic
1130443516 15:83978042-83978064 GGCTGGTTCCTGAGAGGCCAGGG + Intronic
1130691251 15:86083312-86083334 CACTGCTGGGTGACAGCCCACGG - Intergenic
1131027382 15:89155893-89155915 CTCTTGTGACTGACAGGCAAGGG + Intronic
1131147652 15:90024557-90024579 CGCAGGTGGCTGCAAGGCCGTGG + Intronic
1131327754 15:91465222-91465244 CACAGGTGGCTGACTGGGCATGG - Intergenic
1132720554 16:1313659-1313681 CTGTGGTGGCTGACATGGCAGGG - Intronic
1132872734 16:2123000-2123022 TGCTGGGAGCTGACAAGCCAGGG + Intronic
1132976955 16:2715793-2715815 CGCTGGATGCTGACTTGCCAGGG + Exonic
1133031804 16:3014563-3014585 CCTTGGTGGCTGTCAGGCCAAGG + Intergenic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134551821 16:15142179-15142201 TGCTGGGAGCTGACAAGCCAGGG + Intergenic
1134886528 16:17798111-17798133 CACTGATGGCCGAGAGGCCAGGG - Intergenic
1135172387 16:20197259-20197281 CGCTGGAGGCAGACAGACCTGGG + Intergenic
1135334050 16:21586065-21586087 CGCATGTGGCCCACAGGCCATGG - Intergenic
1135348378 16:21708398-21708420 GGCTGGTTCCTAACAGGCCAGGG + Intronic
1136412088 16:30083537-30083559 CGATGATGGCTGACAGGCTGAGG - Exonic
1137023449 16:35452207-35452229 GGCTGGTCGCTGCCAGGGCAAGG - Intergenic
1138516358 16:57537143-57537165 CGATGGTGGTTGGCAGGCCCTGG + Intergenic
1139268597 16:65661841-65661863 AGCTAGTGGCTGGCAGGACAAGG + Intergenic
1139293100 16:65875549-65875571 GGCTGTTTGCTGACAGGTCATGG + Intergenic
1141999822 16:87657917-87657939 AGCTGGTGGCTGCCAGGGGATGG + Intronic
1142263604 16:89053689-89053711 CGTTGGTGGCCGTCAGGGCAGGG - Intergenic
1142534793 17:606645-606667 GCCTGGTTGCTAACAGGCCATGG - Intronic
1143452041 17:7042271-7042293 TGCGGGTGGCTGGCAGACCAAGG - Exonic
1143479070 17:7218352-7218374 CGCTGCTGGCTGGCTGGCAAGGG + Intronic
1144436973 17:15251040-15251062 CGCTGGTGCCTCACAGGCTGTGG - Intronic
1144649265 17:16997316-16997338 TGCTGGTGGCTGGCAGCCCTAGG - Intergenic
1144727122 17:17507536-17507558 CGCTGCTGGTTGCCAGGCCTGGG - Intronic
1145938025 17:28726375-28726397 GGCCGGTGGCCGAGAGGCCACGG - Intronic
1146054634 17:29574941-29574963 AGCTGGTGGCTTAAAGTCCAAGG - Intronic
1147152810 17:38528097-38528119 CGCTGGTGGCTGAGGGTCCCAGG - Intergenic
1147587222 17:41659425-41659447 CCCGGGTGGCTCACAGTCCAGGG + Intergenic
1151696726 17:75721692-75721714 CCCTGAAGGCTGACAGGCCCCGG + Intronic
1151703135 17:75753847-75753869 CGCTGCTGGCCGACAGGCGCGGG - Exonic
1152705881 17:81843413-81843435 AGCTGGTGGCTGCCAGCCCTGGG - Exonic
1152720953 17:81923659-81923681 CGCTGTTGGCTGGCGGGCCAGGG - Intronic
1155071734 18:22322791-22322813 CCCAGGAGGCTGACAGGCCCCGG - Intergenic
1156483851 18:37452469-37452491 TGCTGGCGTCTGACAGCCCAGGG - Intronic
1157322023 18:46642068-46642090 AGCTGTTGGCTCACAGGCCTGGG + Intronic
1160036849 18:75309710-75309732 CGCTGGAGGCCAACAGTCCAAGG + Intergenic
1160965496 19:1745414-1745436 CCCTGGGGGCTGCCAGGCCTGGG - Intergenic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162267672 19:9589229-9589251 CTCTGGTTGCTGAAATGCCAGGG + Intergenic
1163114610 19:15181369-15181391 CTCTGGTGCCTGAGAGGGCATGG - Intronic
1163274597 19:16275524-16275546 AGCTGGTCACTGGCAGGCCAGGG - Intergenic
1165779221 19:38422461-38422483 CGCTGGTTCCTAACAGGCCACGG - Intronic
1165958866 19:39518415-39518437 CTGTGGTGGCTTGCAGGCCACGG + Intronic
1166146947 19:40844599-40844621 CACTGTTTGCTGCCAGGCCACGG - Intronic
1166179206 19:41095110-41095132 CACTGTTTGCTGCCAGGCCACGG + Intronic
1166455835 19:42938751-42938773 GGTTGGTGGCTGCCAGGTCAGGG + Intronic
1167038301 19:47007315-47007337 CTCTGGGTGCTGACTGGCCAAGG + Intergenic
1168451237 19:56468071-56468093 GGCTGGTGGCTGGCAGCCCCTGG - Intronic
924964223 2:60290-60312 AGCAGGTGGCTCCCAGGCCATGG - Intergenic
925170143 2:1745071-1745093 AGCAGGTGGCTGACAGGCCCCGG - Intergenic
925845084 2:8027587-8027609 CCCTCGTGGTTGACAGGCCTCGG - Intergenic
926212202 2:10879314-10879336 TGCTGGTGGCTGACAGTCCATGG + Intergenic
926376245 2:12230873-12230895 CGCATGTGGCCCACAGGCCATGG + Intergenic
926636425 2:15184682-15184704 GTCTGGTACCTGACAGGCCATGG + Intronic
927547901 2:23970977-23970999 ACCTGGTTTCTGACAGGCCATGG + Intronic
929858526 2:45655259-45655281 CACATGTGGCTAACAGGCCATGG - Intronic
935627925 2:105186207-105186229 CTTTGGGGGCTGACAGGCCAGGG + Intergenic
936159211 2:110071285-110071307 CGCTTGAGCCTCACAGGCCAAGG + Intergenic
936185450 2:110300047-110300069 CGCTTGAGCCTCACAGGCCAAGG - Intergenic
936984034 2:118291085-118291107 CTCTCCTGGCTGACAGGCCTGGG + Intergenic
937368922 2:121284723-121284745 CGCAGGGGGCGGACGGGCCAGGG + Intronic
937865866 2:126751548-126751570 CAGTGGTGGCTGAAAGGCCCTGG - Intergenic
937899331 2:127005635-127005657 CCCTGGTGGCTTACAAGCAAGGG - Intergenic
938982479 2:136539772-136539794 CTCTGGAGGCAGACAGGCCTGGG - Intergenic
941298712 2:163773840-163773862 CGCTGGAGACTGACAGGTCGAGG + Intergenic
944422952 2:199550448-199550470 TGCTGGTGGCTGACTGTCCTTGG + Intergenic
948456585 2:238107282-238107304 CGGTGGTGGCCGGCAGGTCAGGG + Intronic
948542147 2:238698794-238698816 TGCTGGTGGGTATCAGGCCAGGG - Intergenic
1168909285 20:1433914-1433936 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1169267180 20:4173920-4173942 AGCTGATGGCTGGGAGGCCAAGG - Intronic
1170146534 20:13181192-13181214 CCCTGGTGGCAAAGAGGCCAAGG - Intergenic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1170903068 20:20484961-20484983 CGCATGTGGCCCACAGGCCATGG - Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1179241795 21:39599369-39599391 CACTGGGGGCAGAGAGGCCAGGG - Intronic
1179485887 21:41710577-41710599 GGCTGGTGGCAGACACGCCCTGG + Intergenic
1179510998 21:41873419-41873441 CGCTGGAAGCTGACGGACCATGG - Intronic
1179954922 21:44733264-44733286 TGCTGGTGGCAGAAAGACCAAGG - Intergenic
1179983214 21:44907143-44907165 TGCAGGAGGCTGACTGGCCATGG + Intronic
1180005733 21:45019546-45019568 TGCAGGGGGCGGACAGGCCAAGG + Intergenic
1180913757 22:19471138-19471160 CTCTGGTGGCTCACACGCCCTGG + Intronic
1180971823 22:19819927-19819949 AGATGGTGGCTGAGTGGCCAGGG - Intronic
1182067806 22:27442873-27442895 GGCTGGTGGTTTAAAGGCCACGG + Intergenic
1182599621 22:31450962-31450984 CGCTTGTGTCTGAGAGGTCAAGG - Intronic
1183276732 22:36903002-36903024 TGCAGGTGGCCCACAGGCCAAGG - Intergenic
1183503764 22:38197007-38197029 CGCTGGTTCCTAACAGGCCACGG + Intronic
1185016658 22:48347187-48347209 CGCTGGGGGCTGACGGGGAAAGG + Intergenic
1185230189 22:49675787-49675809 GGCAGTTGGCTTACAGGCCAGGG - Intergenic
950121552 3:10485328-10485350 AGCTGGTGGGTGACAGGGCTGGG + Intronic
950555541 3:13693644-13693666 CCCTGGAGGTTGGCAGGCCAGGG - Intergenic
950570792 3:13798781-13798803 CAGTGGAGGCAGACAGGCCAAGG - Intergenic
951252188 3:20406841-20406863 TGATGCTGGCTGACAGCCCAGGG - Intergenic
955712598 3:61795981-61796003 GGCTGGTGGGGAACAGGCCAAGG - Intronic
956783111 3:72620051-72620073 CTCTAGAAGCTGACAGGCCAGGG - Intergenic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
959426232 3:106192458-106192480 TGCTGATGGCAGACAGGCTAGGG - Intergenic
959496896 3:107062035-107062057 CTGTGGTGACTGACAGGCCCTGG - Intergenic
959780885 3:110232150-110232172 CACTGGTGGCTCACAGGCCATGG + Intergenic
960997395 3:123349100-123349122 AGCTGGAGGCTGGCAAGCCATGG - Intronic
962490138 3:135885627-135885649 AGCTGGTGGATGACAAGGCAGGG - Intergenic
968258060 3:197297579-197297601 CGCTGCTGGCTCAGGGGCCAAGG - Intronic
968605524 4:1533337-1533359 GGCTGGTGGCTCAGAGGCCTCGG + Intergenic
968764072 4:2459057-2459079 GGCTGGTGGGTGGCAGGGCAGGG - Intronic
968815155 4:2818192-2818214 AGCCGGCGGCTGCCAGGCCAGGG + Exonic
969331430 4:6475393-6475415 TGCTGGTGGCTGAAGGGACACGG - Intronic
975028446 4:69582175-69582197 CGCTTGAGCCTGAGAGGCCAAGG - Intergenic
976151883 4:82100485-82100507 CTCTGGGGGCAGACAGGACAAGG + Intergenic
976273469 4:83252641-83252663 CACTGGTGGAAGACAAGCCAAGG - Intergenic
978338670 4:107697939-107697961 TGCTGGTGGCTGGCAGTCCTTGG - Intronic
979542256 4:121898288-121898310 GCCTGGTTCCTGACAGGCCACGG - Intronic
982358135 4:154491238-154491260 CGCTGCTGCCTGACCGCCCATGG + Intronic
984364969 4:178786525-178786547 AGCTGGTTCCTAACAGGCCATGG + Intergenic
985861922 5:2478009-2478031 TGCTGATGGCTGAGAGGCCCAGG - Intergenic
985927718 5:3030725-3030747 CTCTGGAGGCTGGCAGGACACGG - Intergenic
989249486 5:39293052-39293074 CTCTGGTGGTTGGAAGGCCAGGG + Intronic
990238792 5:53796625-53796647 AGCTGCTAGCTGACAGTCCAGGG + Intergenic
992042359 5:72848508-72848530 CGCGGGTGGCGGCCAGGCCTCGG - Intronic
997199050 5:131998685-131998707 TGGTGGTGGCTGTCAGGCCTGGG - Intronic
999837373 5:155388999-155389021 AGCTTGTGGCTGACAGGCAATGG + Intergenic
1001900371 5:175422098-175422120 CAATGGTGCCTCACAGGCCAAGG + Intergenic
1001931313 5:175675030-175675052 CTCTGGAGGCTGACAGACCTCGG + Intronic
1002172167 5:177381404-177381426 CCCAGGTGGCTGACAGCCCTTGG + Intronic
1007257839 6:40541147-40541169 CGCTGATGGCTGGCTGGCCTGGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1011193962 6:84763772-84763794 CGCTAGTGGCTGAGTGGCCTTGG + Intronic
1015484209 6:133749778-133749800 CCCTGGTTCCTAACAGGCCATGG + Intergenic
1017111780 6:150939566-150939588 TGCTGGAGGGTGACAGGCAACGG - Intronic
1017282000 6:152636149-152636171 CGCTGGAGTCTGACGCGCCAGGG + Intronic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1017508263 6:155088710-155088732 CGCAGGTGGCCCACAGGCCATGG - Intronic
1017918796 6:158853995-158854017 AGCTGGGGTCTGAGAGGCCATGG + Intergenic
1018635687 6:165857318-165857340 CAGAGGTGGCTGAAAGGCCATGG - Intronic
1019165396 6:170094869-170094891 CCCTGGTGGCTGGGAGGCCAGGG + Intergenic
1019653369 7:2172781-2172803 CCCTGCTGGCTGCCAGGTCAAGG + Intronic
1020017960 7:4842486-4842508 CGCTGCTGGCAGAGAGGGCAGGG + Intronic
1022047698 7:26635878-26635900 CGCTGGATGCTGAAAAGCCAAGG + Intergenic
1025078784 7:55964804-55964826 CGCGGGTGGCTGCCCGGCCTCGG + Intronic
1026925683 7:74191451-74191473 AACTGGTGGCGGCCAGGCCATGG - Intronic
1029169815 7:98622540-98622562 AGCTAGTGAATGACAGGCCAGGG - Intronic
1029510274 7:100990139-100990161 TCCTGGTTCCTGACAGGCCACGG - Intronic
1033154271 7:138943336-138943358 CGCTGGGGGCAGACAGCCCAGGG - Intronic
1033283831 7:140024126-140024148 CACCGGTGGATGACAGCCCACGG - Exonic
1033864569 7:145673141-145673163 ACCTGGTTGCTGACAGGCTAAGG - Intergenic
1034009291 7:147510309-147510331 GGCTGGTGGCTTACATGGCAAGG - Intronic
1035898763 8:3434984-3435006 AGCTGGTAGCAGACAGGACAGGG + Intronic
1038469715 8:27804481-27804503 GGCTGGTGGATGAGAGACCATGG + Exonic
1038614658 8:29081302-29081324 GGCTGGTGGCTGCCATGTCAGGG - Intronic
1039608550 8:38901594-38901616 TCCTAGTGGCTGACAGGCGAGGG + Intronic
1040092384 8:43411033-43411055 TGCTGTTGCCTGTCAGGCCAGGG - Intergenic
1040400236 8:47043322-47043344 TGCTGTTGCCTGTCAGGCCAGGG + Intergenic
1041191568 8:55360889-55360911 TGCTGGAGGCTGACAGGCCCAGG + Intronic
1041886755 8:62817824-62817846 CACTGCTGGCTCACAGACCAGGG + Intronic
1043050939 8:75384763-75384785 GCCTGGTACCTGACAGGCCACGG - Intergenic
1044367415 8:91365396-91365418 GGCATGTGGCTCACAGGCCATGG + Intronic
1048499085 8:134959756-134959778 CTCAGGTGGCTGCCATGCCAGGG + Intergenic
1050800307 9:9603489-9603511 GCCTGGTTCCTGACAGGCCAAGG - Intronic
1052038071 9:23705800-23705822 CACTGGTTCCTAACAGGCCACGG + Intronic
1055621327 9:78127822-78127844 TGCAGGGGGCAGACAGGCCACGG + Intergenic
1055644365 9:78348862-78348884 CCCTGGTGGCTGTAAGCCCAGGG + Intergenic
1055829325 9:80360163-80360185 CGCTGCAGGCTCCCAGGCCAGGG - Intergenic
1056821983 9:89848911-89848933 CCTTGGTGCCTGACACGCCATGG - Intergenic
1057132510 9:92664107-92664129 CCCTGGTGACTGACAGACCCCGG - Intronic
1057311725 9:93947428-93947450 TGTTGGTGCCTGAGAGGCCAGGG + Intergenic
1058175482 9:101731579-101731601 GGCTGGTGTCTGATTGGCCAGGG - Intronic
1059333569 9:113553357-113553379 CGCTTGAGCCTGAGAGGCCAAGG + Intronic
1060553487 9:124496623-124496645 CTCTGGTGGCTGACACACCACGG + Intronic
1061862407 9:133474899-133474921 CCCTGGAGGCTGGCAGGGCAGGG - Intronic
1062036886 9:134386375-134386397 CGCAGGTGGCTGGCAGGTGAGGG + Intronic
1062371672 9:136242449-136242471 CCCTGGGGGCACACAGGCCATGG - Intronic
1062495241 9:136828399-136828421 AGCTGGGGGCTGAGTGGCCATGG + Intronic
1062600444 9:137316646-137316668 AGCTGGGGCCTGGCAGGCCAGGG + Intronic
1062634229 9:137481528-137481550 CTCTGGTGGCTGTGATGCCAGGG - Intronic
1185862776 X:3594489-3594511 CGCTTGGGCCTGAGAGGCCAAGG + Intergenic
1187563661 X:20426932-20426954 AGCAGGTGTATGACAGGCCAGGG + Intergenic
1190068748 X:47261836-47261858 GGCTGGTTCCTAACAGGCCATGG + Intergenic
1190301254 X:49058897-49058919 TCCTGGTGGCAGACAGGCAAGGG + Intronic
1190339172 X:49282762-49282784 GGGTGGTGCCTCACAGGCCATGG + Intronic
1192600189 X:72454270-72454292 CCCTGGTGGCAGACAGGAAATGG + Intronic
1195884842 X:109626844-109626866 GGCTGGTTCCTAACAGGCCAAGG - Intronic
1197765557 X:130057369-130057391 CGCTGGAGGCCCAGAGGCCAGGG - Exonic
1198444366 X:136696848-136696870 GACTGGTAGCTGAGAGGCCAGGG - Intronic