ID: 1017313531

View in Genome Browser
Species Human (GRCh38)
Location 6:153002490-153002512
Sequence GGTCAGGAGGCCCGAGTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313531_1017313540 17 Left 1017313531 6:153002490-153002512 CCAGCAACTCGGGCCTCCTGACC 0: 2
1: 0
2: 2
3: 12
4: 177
Right 1017313540 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 9
4: 88
1017313531_1017313537 4 Left 1017313531 6:153002490-153002512 CCAGCAACTCGGGCCTCCTGACC 0: 2
1: 0
2: 2
3: 12
4: 177
Right 1017313537 6:153002517-153002539 AATGGGCTTCAGACCCCGCCTGG 0: 2
1: 2
2: 0
3: 3
4: 89
1017313531_1017313538 13 Left 1017313531 6:153002490-153002512 CCAGCAACTCGGGCCTCCTGACC 0: 2
1: 0
2: 2
3: 12
4: 177
Right 1017313538 6:153002526-153002548 CAGACCCCGCCTGGCGCTCGAGG 0: 2
1: 0
2: 0
3: 13
4: 110
1017313531_1017313544 26 Left 1017313531 6:153002490-153002512 CCAGCAACTCGGGCCTCCTGACC 0: 2
1: 0
2: 2
3: 12
4: 177
Right 1017313544 6:153002539-153002561 GCGCTCGAGGAAGGTCCGCAAGG 0: 2
1: 0
2: 0
3: 2
4: 52
1017313531_1017313545 27 Left 1017313531 6:153002490-153002512 CCAGCAACTCGGGCCTCCTGACC 0: 2
1: 0
2: 2
3: 12
4: 177
Right 1017313545 6:153002540-153002562 CGCTCGAGGAAGGTCCGCAAGGG 0: 2
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313531 Original CRISPR GGTCAGGAGGCCCGAGTTGC TGG (reversed) Exonic
900401433 1:2474456-2474478 GGTCAGGGGGCCTGGGGTGCAGG + Intronic
900643081 1:3696579-3696601 GGCCAGGAGGCACGAGAGGCTGG + Intronic
902306933 1:15547992-15548014 GGTCAGGAGGCATGAGTTTGGGG - Intronic
902932339 1:19740484-19740506 GCTCAGGAGGCTGGAGTTGGTGG - Intronic
903234981 1:21944357-21944379 GGTCAGGAGGCCTGGGTGGGAGG - Intergenic
903257376 1:22111897-22111919 GGGGAGGAGGCCCAGGTTGCAGG + Intergenic
907867562 1:58412992-58413014 GGTAAGGAGTCCCGAATTTCTGG + Intronic
907905752 1:58782885-58782907 GGTGAGGAGGTCCGAGTTCTTGG + Exonic
910146959 1:84091578-84091600 GATCAGGAGGCAGCAGTTGCAGG - Intronic
911856717 1:102886816-102886838 AGTCAGGATGGCTGAGTTGCAGG + Exonic
912492243 1:110068944-110068966 GGTCCGGGGGCCCGAGCTGTCGG + Intronic
913270063 1:117084391-117084413 TGTGAGGAGGCCTGAGATGCCGG + Intronic
914532145 1:148532329-148532351 GGTCAGGAGTCAGGAGTCGCTGG - Exonic
914846876 1:151288367-151288389 GGGCAGGGGGGCCGAGCTGCTGG - Exonic
915650038 1:157302960-157302982 GGGCAGGTGGCCCGAGGTTCTGG - Intergenic
919759312 1:201087440-201087462 GGCCAGGAGGCTGGAGTTTCAGG + Intronic
920100904 1:203516452-203516474 GATGAGGAGGCCAGAGCTGCTGG + Intergenic
922482735 1:225950489-225950511 GGTCAGGAGACCCCATCTGCAGG + Intergenic
923119507 1:230978087-230978109 GGTCAGGAAGCCTGATTTCCAGG + Intronic
1063124781 10:3128582-3128604 GTTCAGGTGCCCAGAGTTGCGGG + Intronic
1064297562 10:14092195-14092217 GGTCAGGTGCCCCTAGTAGCCGG - Intronic
1068652077 10:59533690-59533712 AGTCAGGAAGCAAGAGTTGCTGG + Intergenic
1069548943 10:69349075-69349097 AGGCAGGAGGCCCCAGTAGCAGG + Intronic
1071160389 10:82738888-82738910 GCTAAGGAGGCCCGGGTTGTTGG - Intronic
1071813311 10:89206948-89206970 GGGCAGGAGGGCCGGGCTGCGGG + Exonic
1072682042 10:97514628-97514650 GGTCAGGAGCCCCGAGGAACCGG + Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1073623903 10:105076499-105076521 GGTCAGGAGGCCAGGGTGGATGG - Intronic
1074254300 10:111784912-111784934 AGTGAGAAGGCCCGATTTGCAGG + Intergenic
1079035106 11:17014132-17014154 GATCATGTGGCCCGAGTTGACGG + Exonic
1079366910 11:19817527-19817549 GGTGATGAGGTCCGAGTTGGGGG + Intronic
1080614683 11:33935685-33935707 CGACAGGAGGCCCCAGCTGCTGG - Intergenic
1081915189 11:46726185-46726207 GGGTAGGGGGCCTGAGTTGCAGG + Intronic
1082006241 11:47420733-47420755 GCACAGGAAGCCCGAGATGCTGG + Intronic
1083943275 11:65910181-65910203 GGCCAGGAGGACGAAGTTGCTGG - Intergenic
1084463936 11:69311265-69311287 GGGCAGGAGGCCCCAGTGGGAGG - Intronic
1084690975 11:70726414-70726436 GGTCAGGAGGCTAGAGATGTGGG + Intronic
1084960532 11:72713942-72713964 GGTCAGGAGGCCAGAGAGGTGGG + Intronic
1089317316 11:117600851-117600873 GGCCAGGAGGCCAGAGCTGGAGG + Intronic
1090954527 11:131502596-131502618 GGTCAGGATGCCAGAGACGCCGG - Intronic
1097106800 12:56630458-56630480 GGCAAGGTGGCCAGAGTTGCAGG - Intronic
1097178319 12:57156417-57156439 GGGCAGGTAGCCCGAGTGGCTGG - Intronic
1101579775 12:106032273-106032295 TGGCAGGAGGCTAGAGTTGCAGG + Intergenic
1101894962 12:108749438-108749460 GGTCTGAAGGCCTGAGATGCTGG + Intergenic
1104112478 12:125716922-125716944 GGCCAGGAGGCCCCTGTGGCTGG + Intergenic
1104292041 12:127479248-127479270 GGACAGGAGGCCCACGGTGCTGG - Intergenic
1104425449 12:128673355-128673377 GATCAGGATGCCAGAATTGCTGG - Intronic
1105665579 13:22552328-22552350 GGTCGGGAGGCCAGTGTGGCTGG + Intergenic
1106760232 13:32860490-32860512 GGACAGGAAGGCCGAGTTTCTGG + Intergenic
1106964118 13:35038672-35038694 GGTCATGAGGCCCTTGTTCCAGG - Intronic
1111042665 13:82770414-82770436 GGTCATGAGGCCCCATTTCCAGG - Intergenic
1112053849 13:95671550-95671572 GGTCATGAGGCCCCCATTGCAGG - Intergenic
1114089542 14:19272653-19272675 GGTCATGAGGCCCTTGTTCCAGG + Intergenic
1114671961 14:24416165-24416187 GGGCAAGAGGCCCAATTTGCTGG + Exonic
1121828887 14:97033257-97033279 GGCCAGGGAGCCCGAGCTGCGGG + Intergenic
1122028215 14:98893008-98893030 TGCCAGGAGGCCCCAGTTGATGG - Intergenic
1122362407 14:101175186-101175208 GGGCAGGAGGCCAGAGGTGTGGG + Intergenic
1122720900 14:103721720-103721742 GGCCACGAGGCCAGAGGTGCAGG - Intronic
1122974333 14:105164883-105164905 GCTCAGGAGGCCTGAGGTCCTGG - Intronic
1123793353 15:23746422-23746444 GGTCAGGAGACAGGAGGTGCTGG + Intergenic
1124400272 15:29341820-29341842 TGTCAGGAGGCCCGTGGCGCTGG + Intronic
1128550816 15:68596874-68596896 GGTCAGGAGGCCAGAGTGGCTGG - Intronic
1129464001 15:75713593-75713615 GGTCAGGAGGCCTGGGCTTCTGG - Intergenic
1130100932 15:80893557-80893579 CTTCAGGAGGCCCGAGGAGCTGG + Intronic
1132744248 16:1430163-1430185 GGTCAGGAGGCCAGAGGTCCTGG - Intergenic
1133055815 16:3145003-3145025 TGTCAGGGGTCCCGAGTTGAGGG - Intronic
1133224057 16:4332258-4332280 GGTGAGGGGGCCGGAGTTGGAGG - Exonic
1136355850 16:29744529-29744551 GGTCTGGGGGCCCAAGTTGCTGG + Exonic
1136576340 16:31127494-31127516 GGTCAGGAGGCCTGGATTCCAGG + Intronic
1137925776 16:52540275-52540297 ACTCAGGAGGCCTGAGTAGCTGG + Intronic
1139345991 16:66304273-66304295 GATCAGGAGTCCCCAGTTACTGG + Intergenic
1139827199 16:69766577-69766599 AGTCAGGAGGCCAGTGTGGCTGG - Intronic
1139946915 16:70647961-70647983 GGTCATGAGGCCCATGTTCCAGG + Intronic
1142960253 17:3548079-3548101 GGTCAGGAGGCCACAGTCCCTGG - Intronic
1146339549 17:32007503-32007525 GGTTGGGAGGCCCGAGGGGCTGG - Intergenic
1146633631 17:34488197-34488219 GGTCAGGAGGGCCGCACTGCAGG + Intergenic
1146683195 17:34823256-34823278 GGTCACATGGCCCGAGCTGCAGG + Intergenic
1147057664 17:37846716-37846738 GGTCAGCAGGCCCAGGTTGAAGG + Intergenic
1147158967 17:38559744-38559766 GGTCAGGCGGCCGGAGCAGCGGG - Exonic
1147840611 17:43368993-43369015 GGCCCGGAGGACCGAGTGGCTGG + Intergenic
1149293345 17:55238359-55238381 GGCCAGGAGCCCCTAGCTGCAGG + Intergenic
1149455149 17:56781821-56781843 AGTCAGGAAGCCAGGGTTGCAGG - Intergenic
1150019966 17:61601772-61601794 GAAAAGGAGGCCAGAGTTGCTGG - Intergenic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1152243983 17:79175780-79175802 GGGCAGCAGGTCCGAGCTGCGGG + Intronic
1152926793 17:83091040-83091062 GGTCAGGAGGCCCCCGTGGTGGG + Intronic
1157220921 18:45828120-45828142 GGGCAGGAGGCCCGAGGAGCAGG + Intronic
1160374354 18:78400224-78400246 GGTCAGGAGGCAGGAGGTTCGGG + Intergenic
1161149887 19:2702240-2702262 GGGGAGGAGGCTGGAGTTGCAGG - Intronic
1161257909 19:3320122-3320144 GGCCAGGAGGCCCATGTGGCTGG + Intergenic
1161544235 19:4870253-4870275 AGTGAGGAGGCCCCAGTGGCTGG + Intergenic
1161565739 19:5001138-5001160 AGTCAGGAGGCCGAAGTGGCAGG - Intronic
1161620910 19:5296664-5296686 GGCGAGGAGGCCAGTGTTGCTGG + Intronic
1161629357 19:5344506-5344528 AGCAAGGAGGCCCGAGTGGCGGG - Intergenic
1161715427 19:5873649-5873671 GGCCAGCAGGCCCTAGTCGCAGG - Intronic
1161719740 19:5896202-5896224 AGTGAGGAGGCCCGTGTGGCTGG + Intronic
1162020174 19:7864688-7864710 GGTCATGAGGCCCGGGGGGCCGG - Intronic
1162063566 19:8111242-8111264 GGGCAGGAGGCCCCAGTCACTGG + Intronic
1162617604 19:11814599-11814621 GGACAGGAGGCCCGGGGTCCCGG - Intronic
1164952101 19:32345575-32345597 GGTCAGGTGACCCGAATGGCGGG - Exonic
1166996912 19:46723785-46723807 TGTCAGCAGGCCAGAGCTGCTGG - Intronic
1167612782 19:50515302-50515324 GGTCAAGGTGCCCGAGTTGCAGG - Intergenic
926004117 2:9358771-9358793 GGTCAGGATGCCCAGGTTGGTGG - Exonic
927277356 2:21273175-21273197 GGTCATGAGGTCAGGGTTGCTGG + Intergenic
932258348 2:70305871-70305893 GGCCAGGAGGCCCGGGATGAGGG + Intergenic
932587025 2:73036729-73036751 GGTCAGGAGGCCATAGAGGCAGG + Intronic
933857425 2:86429272-86429294 GGTCAAGAGGGTGGAGTTGCTGG - Intergenic
944715995 2:202376482-202376504 CGTCAGGAGCCCAGAGCTGCGGG + Intergenic
945111113 2:206360703-206360725 GGACAGTAGGCCTGAGTTCCAGG + Intergenic
947604047 2:231472419-231472441 GATCAGGAGGCCAGAGATGGAGG - Intronic
948653573 2:239463773-239463795 GGCCAGGAGGCCTCAGGTGCAGG + Intergenic
1168876814 20:1177561-1177583 GGTCAAGAGGCACGTGTGGCTGG + Intronic
1168926997 20:1589746-1589768 TCTCAGGAGGCCTGGGTTGCTGG - Intronic
1168935187 20:1658824-1658846 TCTCAGGAGGCCTGGGTTGCTGG - Intergenic
1172269979 20:33649463-33649485 GGTTAGGAGGCCTGAGGGGCGGG + Exonic
1175350538 20:58314988-58315010 GGTCAGGAGGCCGGGGTGGCTGG + Intronic
1175923475 20:62460952-62460974 GGTCAGGAAGCCCCAGCTGACGG + Intergenic
1177744730 21:25197920-25197942 GGTCCAAAGGCCTGAGTTGCAGG + Intergenic
1178898731 21:36582530-36582552 GGACAGGAAGCCTGAGTTGCAGG - Intergenic
1179504639 21:41832558-41832580 GTTCAGGAGGCCCAGGTTGAGGG - Intronic
1180200754 21:46222728-46222750 GATCAGGAGGCCTGTGTGGCAGG + Exonic
1180491161 22:15849694-15849716 GGTCATGAGGCCCTTGTTCCAGG - Intergenic
1180971919 22:19820324-19820346 GGTGAGGAGGCCAGAGCTCCAGG - Intronic
1181527200 22:23496702-23496724 GGTGAGGAGGCCAGAGGTGTGGG + Intergenic
1182299002 22:29327618-29327640 GGGCAGGAGTCCCGGGCTGCAGG - Intergenic
1185119049 22:48954903-48954925 GGACAGGAGGCCCCAGGGGCAGG - Intergenic
954411370 3:50372677-50372699 GGGCTGGAGGCCTGAGATGCAGG - Intronic
955251350 3:57285769-57285791 GGTCAGGAGGCCCCAGGTAGAGG - Intronic
960940076 3:122927768-122927790 GGTAAGGAGGCCCCAGTGCCAGG - Exonic
962853913 3:139327799-139327821 GGCCAGGAGGCCTTAGTTGTGGG - Intronic
962869789 3:139477948-139477970 GGGTAGGAGGCCTCAGTTGCAGG - Intronic
965742432 3:171890014-171890036 AGTCATGAGGCCCCAGTTCCAGG - Intronic
969995296 4:11306188-11306210 GGACAGGAGTGCAGAGTTGCTGG - Intergenic
978271163 4:106892850-106892872 TGTCTGGAGGCCCCGGTTGCGGG - Intergenic
984529809 4:180902254-180902276 AGTCAGGAGGTCCCAGTTCCAGG - Intergenic
985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG + Intergenic
993533737 5:89055242-89055264 GGTCAGCGGGACAGAGTTGCAGG - Intergenic
999133356 5:149301034-149301056 GGTCAGGAGGCCTGAGTGTGAGG - Intronic
999195388 5:149778269-149778291 GGTGAGGAGGCCTGGGTTCCTGG + Intronic
999196101 5:149782722-149782744 GGTCACGAGGCCCCGGGTGCTGG + Intronic
999251239 5:150183616-150183638 GGCCAGGAGGCTGGTGTTGCTGG - Exonic
1001131477 5:169067607-169067629 AGTCAGGATGCCCAAGTAGCAGG - Intronic
1001907391 5:175484404-175484426 GGTCAGGAGGGCCGGGTTGTGGG - Intronic
1003742645 6:8960658-8960680 TGTCAGGAGGCCCGTGTGGCAGG - Intergenic
1004285357 6:14316206-14316228 GAGCAGGAGGCCTGCGTTGCAGG + Intergenic
1005354249 6:24967532-24967554 TGTCAGAAGGCCTGAGTTGCAGG - Intronic
1006390669 6:33756402-33756424 AGTCAGGAGGCCAGTGTGGCTGG + Intergenic
1006432637 6:34007370-34007392 AGTGAGGAGGCCCAAGTGGCTGG + Intergenic
1007077120 6:39075045-39075067 AGTCAGGAGGCCTGGGTTCCAGG - Intronic
1007394433 6:41569620-41569642 GGCCAGGAGGGCCGAGCTGGTGG + Intronic
1008752258 6:54749935-54749957 GGTCAGGAGTGTGGAGTTGCTGG + Intergenic
1015820830 6:137258717-137258739 GGTCAGGAAGACTGAGTGGCTGG + Intergenic
1017313531 6:153002490-153002512 GGTCAGGAGGCCCGAGTTGCTGG - Exonic
1017745700 6:157444985-157445007 TGTGAGGAGGCCAGAGTTGAGGG + Intronic
1018181538 6:161227539-161227561 GGTTGGGAGCTCCGAGTTGCTGG - Intronic
1024062536 7:45709717-45709739 GGCCAGAAAGCCCCAGTTGCAGG + Intronic
1025007635 7:55366426-55366448 GGCCAGGAGGGCCGAACTGCTGG - Intronic
1027503450 7:78984482-78984504 AGACAGGAGGCCAGATTTGCTGG - Intronic
1030235333 7:107253758-107253780 AGCCAGGAGGCCCGAGTGGCTGG - Intronic
1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG + Intergenic
1032583741 7:133128099-133128121 GGTCATGAGGCCTAAGTGGCAGG - Intergenic
1033728434 7:144147204-144147226 GGTCAGGAGGCCAAAGCTGCTGG - Intergenic
1034466457 7:151232699-151232721 GGGGAGGAGGCCCGGGTTTCAGG - Exonic
1035255067 7:157620932-157620954 GGGCAGGAGGCCTGGGTTACAGG - Intronic
1035255087 7:157620997-157621019 GGGCAGGAGGCCTGGGTTACAGG - Intronic
1035255163 7:157621257-157621279 GGGCAGGAGGCCAGGGTTCCGGG - Intronic
1037272603 8:17146127-17146149 CGTCAGGAGACCCGGGTTCCTGG + Intergenic
1037789080 8:21920298-21920320 GGGAAGGAGGCCGGGGTTGCTGG - Intronic
1037883946 8:22586527-22586549 GAGCAGGAGGCCCGACATGCTGG + Intronic
1037938133 8:22928696-22928718 AGCCAGGAGTCCTGAGTTGCTGG - Intronic
1037939979 8:22944036-22944058 GGTCAGGAGGCAGGAGGAGCCGG - Intronic
1042056824 8:64772822-64772844 GGTAAGGAGGCCAGTGTTGTGGG - Intronic
1042665424 8:71199373-71199395 GGCCATGAGGTCCGAGTGGCTGG + Exonic
1043340303 8:79229804-79229826 AGTCATGAGGCCCCTGTTGCAGG - Intergenic
1043724326 8:83590593-83590615 AGTCAGGAGGCCCTTGTTCCAGG - Intergenic
1046701397 8:117404925-117404947 GGTCATGTGGCCCAGGTTGCAGG - Intergenic
1047371043 8:124256403-124256425 AGTCAGAAGGCCCGGGTTGAGGG - Intergenic
1047525745 8:125632809-125632831 GGTCTGGAGGCCAGAGTGGAAGG - Intergenic
1047675647 8:127198498-127198520 GGTAAGGAGGCCAGTGTGGCTGG + Intergenic
1047931131 8:129728921-129728943 GGTCAGGAGGCCCGAGGTGGTGG + Intergenic
1049411125 8:142474465-142474487 GGGCAGGAGGCCCGAGCGGGAGG + Intronic
1052134620 9:24894483-24894505 GGTCAGGAGGCAACAGATGCTGG + Intergenic
1054948481 9:70823004-70823026 GGTCAGGATGCCAGAGATGCTGG - Intronic
1060046842 9:120348261-120348283 GGTCAGGAAGCCTGACTGGCTGG + Intergenic
1189325244 X:40107683-40107705 GGTCAGGAGGCCCGCCCCGCGGG - Intronic
1189847615 X:45151199-45151221 GGTCAGGAGGCTGGAGTGGAGGG - Exonic
1190702110 X:52996834-52996856 AGTGAGGAGGCCAGTGTTGCTGG + Intergenic
1191897417 X:66007715-66007737 TGTCAGGAGACCTGAGTTCCAGG - Intergenic
1192853244 X:74980269-74980291 AGTCATGAGGCCCTAGTTCCGGG + Intergenic
1195127367 X:101821990-101822012 AGTCAGGAGGCGCGAGGTTCAGG + Intergenic
1195344887 X:103940115-103940137 TGTCAGGAGGCACGAGTGTCAGG + Intronic
1200098328 X:153674425-153674447 CGTCAGGAGGCCAGTGTGGCCGG - Intronic
1201677565 Y:16604234-16604256 AGTCTGAAGGCCCGAGATGCAGG - Intergenic