ID: 1017313539

View in Genome Browser
Species Human (GRCh38)
Location 6:153002530-153002552
Sequence CCTTCCTCGAGCGCCAGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313539_1017313546 -3 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313546 6:153002550-153002572 AGGTCCGCAAGGGCCCGCCCCGG 0: 2
1: 0
2: 2
3: 5
4: 85
1017313539_1017313554 17 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313554 6:153002570-153002592 CGGGTGAACAGCTCCTCCAGCGG 0: 1
1: 0
2: 2
3: 6
4: 78
1017313539_1017313547 -2 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313547 6:153002551-153002573 GGTCCGCAAGGGCCCGCCCCGGG 0: 2
1: 0
2: 1
3: 10
4: 129
1017313539_1017313555 20 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313555 6:153002573-153002595 GTGAACAGCTCCTCCAGCGGCGG 0: 1
1: 0
2: 1
3: 6
4: 97
1017313539_1017313556 21 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313556 6:153002574-153002596 TGAACAGCTCCTCCAGCGGCGGG 0: 1
1: 0
2: 2
3: 10
4: 148
1017313539_1017313557 28 Left 1017313539 6:153002530-153002552 CCCCGCCTGGCGCTCGAGGAAGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 1017313557 6:153002581-153002603 CTCCTCCAGCGGCGGGCTACCGG 0: 1
1: 1
2: 0
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313539 Original CRISPR CCTTCCTCGAGCGCCAGGCG GGG (reversed) Exonic