ID: 1017313715

View in Genome Browser
Species Human (GRCh38)
Location 6:153003464-153003486
Sequence TGAAGGCTTTGTTGGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313715_1017313718 -7 Left 1017313715 6:153003464-153003486 CCTACAGCCCAACAAAGCCTTCA No data
Right 1017313718 6:153003480-153003502 GCCTTCAGATATCTGCCTCCAGG No data
1017313715_1017313725 25 Left 1017313715 6:153003464-153003486 CCTACAGCCCAACAAAGCCTTCA No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313715 Original CRISPR TGAAGGCTTTGTTGGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr