ID: 1017313716

View in Genome Browser
Species Human (GRCh38)
Location 6:153003471-153003493
Sequence AGATATCTGAAGGCTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313716_1017313725 18 Left 1017313716 6:153003471-153003493 CCCAACAAAGCCTTCAGATATCT No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313716_1017313730 29 Left 1017313716 6:153003471-153003493 CCCAACAAAGCCTTCAGATATCT No data
Right 1017313730 6:153003523-153003545 CCAAAGAACTGGTAGCGGATAGG No data
1017313716_1017313728 24 Left 1017313716 6:153003471-153003493 CCCAACAAAGCCTTCAGATATCT No data
Right 1017313728 6:153003518-153003540 CCTTTCCAAAGAACTGGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313716 Original CRISPR AGATATCTGAAGGCTTTGTT GGG (reversed) Intergenic
No off target data available for this crispr