ID: 1017313721

View in Genome Browser
Species Human (GRCh38)
Location 6:153003498-153003520
Sequence AGGGATGAGGGTTGGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313721_1017313730 2 Left 1017313721 6:153003498-153003520 CCAGGAGTCCAACCCTCATCCCT No data
Right 1017313730 6:153003523-153003545 CCAAAGAACTGGTAGCGGATAGG No data
1017313721_1017313725 -9 Left 1017313721 6:153003498-153003520 CCAGGAGTCCAACCCTCATCCCT No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313721_1017313728 -3 Left 1017313721 6:153003498-153003520 CCAGGAGTCCAACCCTCATCCCT No data
Right 1017313728 6:153003518-153003540 CCTTTCCAAAGAACTGGTAGCGG No data
1017313721_1017313732 27 Left 1017313721 6:153003498-153003520 CCAGGAGTCCAACCCTCATCCCT No data
Right 1017313732 6:153003548-153003570 CCAGCAATACCGACATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313721 Original CRISPR AGGGATGAGGGTTGGACTCC TGG (reversed) Intergenic
No off target data available for this crispr