ID: 1017313725

View in Genome Browser
Species Human (GRCh38)
Location 6:153003512-153003534
Sequence CTCATCCCTTTCCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017313719_1017313725 8 Left 1017313719 6:153003481-153003503 CCTTCAGATATCTGCCTCCAGGA No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313715_1017313725 25 Left 1017313715 6:153003464-153003486 CCTACAGCCCAACAAAGCCTTCA No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313717_1017313725 17 Left 1017313717 6:153003472-153003494 CCAACAAAGCCTTCAGATATCTG No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313721_1017313725 -9 Left 1017313721 6:153003498-153003520 CCAGGAGTCCAACCCTCATCCCT No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313716_1017313725 18 Left 1017313716 6:153003471-153003493 CCCAACAAAGCCTTCAGATATCT No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data
1017313720_1017313725 -6 Left 1017313720 6:153003495-153003517 CCTCCAGGAGTCCAACCCTCATC No data
Right 1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017313725 Original CRISPR CTCATCCCTTTCCAAAGAAC TGG Intergenic
No off target data available for this crispr