ID: 1017320345

View in Genome Browser
Species Human (GRCh38)
Location 6:153084671-153084693
Sequence GTGGACAGACAGCTTTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017320341_1017320345 10 Left 1017320341 6:153084638-153084660 CCTCAGAAGACTGGAATACAGTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1017320345 6:153084671-153084693 GTGGACAGACAGCTTTAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017320345 Original CRISPR GTGGACAGACAGCTTTAGCT AGG Intronic
900483227 1:2909453-2909475 GTGGTCACACAGCTTGAACTTGG + Intergenic
901396163 1:8983352-8983374 GTGGGAGGACAGCTTGAGCTGGG + Intergenic
903131997 1:21285527-21285549 CTGGAAAGACAGCTTTGGCCAGG + Intronic
903788846 1:25878872-25878894 CTGGACAGACAGGTCTTGCTGGG + Intergenic
904293359 1:29502027-29502049 GTGGAAAGACAGCTTGAGCCAGG - Intergenic
906233446 1:44186261-44186283 GTGGACAGATAGCTTGAGCCTGG - Intergenic
907421556 1:54351053-54351075 GTGGGCAGATTGCTTGAGCTAGG - Intronic
907697342 1:56745509-56745531 GTGGACAGATGGCTTTGGATTGG - Intronic
908129957 1:61065319-61065341 GTGGAAAGACTGCTTGAGCCTGG - Intronic
908481231 1:64541577-64541599 GTGGACAGATTGCTTGAGCCCGG + Intronic
910249776 1:85184766-85184788 GTGGGAAGACTGCTTGAGCTGGG + Intronic
910983348 1:92980318-92980340 GTGGGCAGATAGCTTGAGCCCGG - Intergenic
912509256 1:110177095-110177117 GTGGGAAGTCAGGTTTAGCTAGG + Intronic
912564196 1:110573898-110573920 TTGGACTGACAGCTCTAGCTAGG - Intergenic
914347185 1:146809856-146809878 GTGGGCAGATTGCTTGAGCTCGG - Intergenic
915118472 1:153614461-153614483 CTGGACAGACAGCTATGGTTTGG + Exonic
916884501 1:169053909-169053931 GTGGGAGGACTGCTTTAGCTTGG - Intergenic
916954002 1:169812627-169812649 GTGGGCAGATTGCTTGAGCTAGG + Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
919946771 1:202325182-202325204 GTGGGCAGATTGCTTGAGCTTGG + Intergenic
922870333 1:228897535-228897557 GTGGGCAGACAGCATCATCTTGG + Intergenic
924265457 1:242277113-242277135 GGGGACAGACAACATTATCTTGG + Intronic
1066440977 10:35438240-35438262 GTGGGAGGACAGCTTTAGCCTGG - Intronic
1066719370 10:38321363-38321385 GGGGACAGACAACATTATCTTGG - Intergenic
1070559583 10:77556052-77556074 GTGGACAGAGAGAAATAGCTTGG + Intronic
1072348101 10:94529102-94529124 GTGGGCAGACTGCTTAAGCCTGG - Intronic
1072707979 10:97695858-97695880 GTGGGCAGATTGCTTGAGCTCGG - Intergenic
1072797226 10:98365361-98365383 GTAGAGACACAGCTTTAGATGGG + Intergenic
1074385152 10:113010783-113010805 GTGGACAGATCTCTTGAGCTCGG + Intronic
1076664802 10:132080746-132080768 GTGGGCAGACTGCTTGAGGTTGG - Intergenic
1077087507 11:761768-761790 GTGGAAAGATAGCTTGAGCCTGG - Intronic
1080424881 11:32146251-32146273 ATGGACATACAGGTTTTGCTTGG + Intergenic
1080762166 11:35262184-35262206 GTGAACAGACAACTTTCTCTGGG - Intronic
1082902638 11:58272171-58272193 GTGGAGACACAGTTTTAGTTTGG - Intergenic
1083259254 11:61514356-61514378 AGGGACAGACAGCTTTGGATGGG + Intergenic
1084012520 11:66360559-66360581 GTGGGCAGGCAGCAGTAGCTGGG + Intronic
1084071477 11:66739033-66739055 GTGGGCAGATCGCTTGAGCTCGG - Intergenic
1086867079 11:91992739-91992761 GTGGGAAGATAGCTTTTGCTTGG - Intergenic
1088595993 11:111440668-111440690 GTTCACAGATAGCTTTAGATGGG + Intronic
1088656243 11:112002692-112002714 GTGGAAGGACAGCTTTAGCCTGG + Intronic
1091709256 12:2726159-2726181 GTATTCAGACAGCCTTAGCTTGG + Intergenic
1092188307 12:6498135-6498157 GTGGGCAGATCGCTTGAGCTCGG - Intronic
1093171399 12:15865016-15865038 GTGGACAGATTGCTTGAGCCAGG + Intronic
1094553879 12:31478605-31478627 GTGGGAAGACAGCTTGAGCACGG + Intronic
1094651634 12:32384265-32384287 GTGAGCAGACAGCTTTTGCCAGG - Intergenic
1094720427 12:33057633-33057655 GTTGACATACACTTTTAGCTTGG + Intergenic
1096364700 12:51018672-51018694 GTGGGCAGACTGCTTGAGCCTGG + Intronic
1096731463 12:53616448-53616470 GTGGGCAGATTGCTTGAGCTTGG - Intronic
1097443310 12:59638188-59638210 CTGAACAGACAGGTTTTGCTGGG - Intronic
1097875145 12:64636340-64636362 GTGGACAGATAGCCTGAGGTCGG - Intronic
1099737756 12:86592616-86592638 AGGGAGAGGCAGCTTTAGCTAGG + Intronic
1100152920 12:91762957-91762979 GTGGAAAGATGGCTTGAGCTTGG + Intergenic
1100519959 12:95365125-95365147 GTGGGCAGACTGCTTGAGCCGGG - Intergenic
1104441448 12:128796839-128796861 GTGGCCTGCCAGCTTTAGCTCGG - Intronic
1107306331 13:39023985-39024007 GTGGACAGGCAGGTTTTGCAAGG + Intronic
1111640452 13:90963029-90963051 GTGGGCAGATTGCTTGAGCTCGG + Intergenic
1114079736 14:19193572-19193594 GTGGGAAGATAGCTTGAGCTTGG - Intergenic
1117899798 14:60520058-60520080 GTGCACAGGCAGCATTACCTTGG - Intergenic
1118907368 14:70032556-70032578 GTGCACAAACACCTTTAGCAAGG - Intergenic
1118928998 14:70222506-70222528 CTATATAGACAGCTTTAGCTAGG + Intergenic
1119363304 14:74069943-74069965 GTGGGAAGACAGCTTGAGCCTGG - Intronic
1120894383 14:89516789-89516811 GTGGACAGATCGCTTGAGCTCGG - Intronic
1121052105 14:90826184-90826206 GTGGACAGACCACTTGAGGTCGG - Intergenic
1122748633 14:103916650-103916672 GTGGGAAGACTGCTTGAGCTTGG + Intronic
1122862905 14:104590424-104590446 GTGGACAGACAGCAGCGGCTGGG - Intronic
1122985128 14:105208414-105208436 CAGGACAGACAGCTCTGGCTGGG - Intergenic
1125137332 15:36358799-36358821 GTGGGCAGAGAGCTTGAGCCTGG - Intergenic
1125724598 15:41861887-41861909 CTGGACAGACAGCATCAGCCTGG - Exonic
1126198725 15:45961081-45961103 GTGGACAGCCAACTTGAGATAGG - Intergenic
1126207485 15:46061584-46061606 GTGGAGATACAGCATTACCTAGG + Intergenic
1126406032 15:48323664-48323686 GTGGACGGATTGCTTGAGCTTGG - Intergenic
1127250252 15:57227667-57227689 GTGAACAGACAGTTCTAACTTGG - Intronic
1127441755 15:59016063-59016085 GTGGGCAGACTGCTTGAGCTAGG - Intronic
1127514237 15:59676261-59676283 GAGGAGAGAGAGCTTGAGCTTGG - Intronic
1127609405 15:60622382-60622404 GTGGGCAGATTGCTTGAGCTCGG + Intronic
1128986804 15:72228265-72228287 CTGCACAGACGGCATTAGCTGGG + Intronic
1129094993 15:73197129-73197151 GTGGGCAGATCGCTTGAGCTCGG + Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1130211783 15:81930658-81930680 GTGGAAGGACAGCTTGAGCCAGG - Intergenic
1130330139 15:82916047-82916069 GGGGACAGAAAGTTGTAGCTAGG - Intronic
1132768922 16:1550166-1550188 GTGGACAGATTGCTTGAGCCCGG - Intronic
1133585725 16:7192962-7192984 GTCGACAGACATCTTTGGGTTGG + Intronic
1137574872 16:49592931-49592953 GTGGAGAGACAGCTTTCGTGCGG + Intronic
1138128750 16:54460515-54460537 GTGGACAGACAGAGCCAGCTAGG + Intergenic
1139197224 16:64933556-64933578 GTGGAAAGAGATCTTTAGTTTGG - Intergenic
1139986805 16:70905412-70905434 GTGGGCAGATTGCTTGAGCTCGG + Intronic
1142277680 16:89131352-89131374 GCGGGCAGACTGCTTGAGCTCGG - Intronic
1142592126 17:1010880-1010902 GAGGTCAGGCAGCCTTAGCTGGG + Intronic
1143041308 17:4039237-4039259 GTGGGCAGACTGCTTGAGATCGG + Intronic
1143144997 17:4769284-4769306 GTGGGAAGACAGCTTGAGCTAGG + Intergenic
1143768821 17:9154895-9154917 GTGGACAGAGAGCCTTTGCAAGG - Intronic
1144687805 17:17237518-17237540 GTGGACAGGAAGCCTTAGGTTGG - Intergenic
1145388841 17:22439224-22439246 GTGGGCAGATTGCTTGAGCTAGG + Intergenic
1146572781 17:33967327-33967349 GTGGAAAGATTGCTTTAGCCTGG - Intronic
1148340552 17:46871002-46871024 GTGGAAGGATAGCTTGAGCTCGG - Intronic
1148846205 17:50531623-50531645 GAGGACAGACAGACATAGCTGGG + Intergenic
1150097759 17:62393315-62393337 GTGGACAGACTGCAATGGCTGGG + Intronic
1152524751 17:80881588-80881610 GCTGACAGACTGCTTGAGCTCGG + Intronic
1152658323 17:81530267-81530289 GTGGGCAGGCAGCTTTACCCGGG + Intronic
1152666748 17:81574783-81574805 GTGGGCAGACGGCTTGAGGTCGG + Intronic
1153297647 18:3562920-3562942 GTGGAAAGATTGCTTGAGCTTGG - Intronic
1153648088 18:7213159-7213181 GTGCACAGACACCTTTCTCTGGG + Intergenic
1154051696 18:10966332-10966354 AAGGAATGACAGCTTTAGCTAGG - Intronic
1155147486 18:23096201-23096223 GTGGGAAGATCGCTTTAGCTCGG + Intergenic
1155485167 18:26333477-26333499 GTGGGTAGACAGCTTGAGCCTGG - Intronic
1159629803 18:70736330-70736352 GTGGCCAGGAAGCTTGAGCTCGG + Intergenic
1160052625 18:75449979-75450001 GTGGAGGGACTGCTTGAGCTTGG + Intergenic
1163395637 19:17059106-17059128 GTGGAGAGACAGCAGCAGCTGGG + Intronic
1164948810 19:32318834-32318856 ATGGACAGACTGCTTCTGCTGGG - Intergenic
1167555381 19:50191739-50191761 ATGGGCAGACAGCTTAAGCCTGG + Intronic
930068973 2:47350346-47350368 GTGGAAGGATCGCTTTAGCTTGG - Intronic
930361744 2:50389072-50389094 GTGGGAAGACAGCTTGAGCCTGG + Intronic
930803074 2:55462624-55462646 GTGGACAGGAAGCTTAAACTGGG + Intergenic
932643355 2:73474566-73474588 GTGGAAGGATAGCTTGAGCTCGG - Intronic
933847817 2:86339467-86339489 GTGGACAAACATCTTTATCATGG - Intergenic
936382313 2:111997485-111997507 GTGGGCAAACATTTTTAGCTGGG - Intronic
936450598 2:112631125-112631147 GTGGATGGACAGCTGTAGCCTGG - Intergenic
936597834 2:113866217-113866239 GAGGAGAGACAGCTTTAGGCAGG + Intergenic
937701682 2:124869189-124869211 GTGGGCAGAGAGCTTTTCCTGGG - Intronic
938008182 2:127806017-127806039 GTGGGCAGATTGCTTGAGCTGGG + Intronic
938181623 2:129189829-129189851 GAGCACAGACAGCTTTAGGGTGG + Intergenic
941285705 2:163610272-163610294 GTGGACTGACGGCCTTACCTCGG - Exonic
943197351 2:184771377-184771399 GTGTCCAGACAGGTTTTGCTGGG + Intronic
943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG + Intergenic
945971766 2:216237893-216237915 GTAAACCAACAGCTTTAGCTGGG + Intergenic
1170801706 20:19595818-19595840 GTGGAGGAACAGCTTTAGCGAGG + Intronic
1170981605 20:21219544-21219566 GTGGGCAGACTGCTTGAGGTCGG - Intronic
1172800202 20:37571053-37571075 CTGGCCAGCCAGCTTTTGCTAGG - Intergenic
1174348305 20:49948177-49948199 GTGGGCAGGCAGCTGTAGCTGGG - Intronic
1174348509 20:49949544-49949566 GCGGGCAGGCAGCTGTAGCTGGG + Intronic
1174462206 20:50691055-50691077 GTGGACAGACTTCTGGAGCTGGG - Intronic
1174632925 20:51973809-51973831 GTGGGCAGACTGCTTGAGCCTGG + Intergenic
1174759169 20:53189853-53189875 GTGGGCAGATTGCTTAAGCTTGG + Intronic
1174972510 20:55292222-55292244 GTGGCCAGACAGCTCTTGCTGGG + Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1177370510 21:20197465-20197487 GTGGACAGAGAGTTTTCTCTAGG - Intergenic
1178687426 21:34722710-34722732 GTGGGCTGACAGCTCTATCTGGG + Intergenic
1180501035 22:15929128-15929150 GTGGGAAGATAGCTTGAGCTTGG + Intergenic
1180578815 22:16809850-16809872 GTGGAAAGATCGCTTGAGCTTGG - Intronic
1180985535 22:19901968-19901990 GTGGACAGACTGCTTGAGCCCGG + Intronic
1182128098 22:27830878-27830900 GTGGGAAGACTGCTTGAGCTCGG - Intergenic
1183926165 22:41207765-41207787 GTGGGAAGACAGCTTGAGCCTGG - Intronic
950906852 3:16546307-16546329 GAGGACAGACAGCTTTGCCAAGG + Intergenic
950929825 3:16777363-16777385 GTGGACAGAGAGCTTAATCCAGG - Intergenic
951473298 3:23078959-23078981 GTGGGCAGACTGCCTGAGCTCGG + Intergenic
952306246 3:32149151-32149173 GTGGGAGGACAGCTTGAGCTTGG - Intronic
952758357 3:36891901-36891923 TAGGACAGACAGCTGTTGCTGGG - Intronic
953324955 3:42005179-42005201 GTGGAAAGACAGCTTGAGCCTGG - Intergenic
956583092 3:70835576-70835598 GTGGGCAGATTGCTTGAGCTCGG - Intergenic
959716269 3:109436349-109436371 ATGGGCAGACTGCTTGAGCTGGG - Intergenic
962769109 3:138595674-138595696 ATGTACAGACAGCTTAAGCCTGG + Intergenic
962842422 3:139247766-139247788 GTGGGCAGATGGCTTGAGCTTGG - Intronic
963463269 3:145644851-145644873 GTGGAAGGACAGCTTGAGCCTGG - Intergenic
967994328 3:195155201-195155223 GTGAAGAGGCAGCTTCAGCTCGG - Intronic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
972031927 4:34471504-34471526 ATGGAAAGACAGCATTATCTGGG + Intergenic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
976732756 4:88280753-88280775 GTGGACAGATTGCTTGAGCCTGG + Intronic
978168807 4:105643958-105643980 GTGGGCAGATTGCTTAAGCTGGG - Intronic
978675183 4:111305330-111305352 GTGGGCAGATTGCTTTAGCTTGG - Intergenic
983929563 4:173438349-173438371 GTGGGCAGATAGCTTGAGCCCGG - Intergenic
990582580 5:57179823-57179845 GTGGACAGACATCTGAAGTTAGG - Intronic
991586599 5:68208336-68208358 GTGGGCAGACTGCTTGAGCCTGG - Intergenic
993972574 5:94438151-94438173 GGGGACAGAAAGCTCTGGCTGGG + Intronic
997453581 5:134002397-134002419 GTGGATGGACAGCTTGTGCTGGG - Intronic
997531372 5:134583512-134583534 GTGGGAAGACAGCTTGAGCGCGG - Intergenic
998014123 5:138718718-138718740 GTGGGCAGACTGCTTGAGCCTGG + Intronic
998160867 5:139812318-139812340 GTGGAAGGAGGGCTTTAGCTGGG + Intronic
998638712 5:143985719-143985741 CTGAACAGGCTGCTTTAGCTGGG - Intergenic
998885928 5:146693441-146693463 GTGGGCAGACTGCTTGAGCCTGG - Intronic
999645882 5:153716663-153716685 TTGGAAAGTCAGCTTCAGCTGGG + Intronic
1000092073 5:157938441-157938463 GTGGGCAGATTGCTTGAGCTAGG + Intergenic
1001066777 5:168541122-168541144 GTGGAAGGACAGCTTGAGCCTGG + Intergenic
1001529365 5:172451658-172451680 CTGGAGAGACAGCATCAGCTGGG - Intronic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1002349676 5:178575299-178575321 GTGGAAAGACAGCCTTAGGAAGG - Intronic
1002404720 5:179021096-179021118 GTGGGCAGATGGCTTGAGCTCGG - Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1003590721 6:7434442-7434464 GTGGACAAATCGCTTGAGCTCGG - Intergenic
1007728222 6:43929664-43929686 GTGGACAGACTGCCAGAGCTGGG + Intergenic
1009289756 6:61868192-61868214 GTGGCCAGACTGCTTTAAATGGG - Intronic
1010568731 6:77451894-77451916 GTGGACAGCCACCTTTAACATGG + Intergenic
1011578952 6:88836511-88836533 GTGGGCAGACTGCTTGAGCTCGG + Intronic
1011585628 6:88922132-88922154 GTGGAAAGACTGCTTGAGCCTGG - Intronic
1011658624 6:89575058-89575080 GTAGACAGACAGGCTTTGCTGGG - Intronic
1012020632 6:93914175-93914197 GTGAATAAACAGCTTTAGCGAGG + Intergenic
1013576571 6:111489153-111489175 GTGGAAGGATAGCTTGAGCTTGG + Intergenic
1015094757 6:129401977-129401999 GTGGGCAGACTGCCTGAGCTCGG + Intronic
1016370224 6:143366081-143366103 GTGTACAGCCACCATTAGCTTGG - Intergenic
1017320345 6:153084671-153084693 GTGGACAGACAGCTTTAGCTAGG + Intronic
1018336149 6:162792168-162792190 GTTGACAGAGAGCTTGATCTAGG + Intronic
1019492347 7:1321368-1321390 GGGGACAAACAGCTTTGCCTAGG + Intergenic
1020247602 7:6442007-6442029 GTGGAGACACAGCTTCAGCCAGG + Intronic
1026759331 7:73114764-73114786 GTGGGCAGACTGTTTGAGCTTGG - Intergenic
1027088078 7:75278710-75278732 GTGGGCAGACTGTTTGAGCTTGG + Intergenic
1029340690 7:99941505-99941527 GTGGGCAGATTGCTTAAGCTTGG + Intergenic
1030124621 7:106142112-106142134 GTGGGCACACAACTTAAGCTAGG - Intergenic
1030435079 7:109507807-109507829 GTGGGTAGACCGCTTGAGCTTGG + Intergenic
1031918650 7:127585571-127585593 GTCGGCAGGCAGCTTTAGTTAGG - Exonic
1033019816 7:137712946-137712968 ATGGTCAGCCAGCTTCAGCTTGG + Intronic
1033317670 7:140311456-140311478 GTGGACAGATTGCTTGAGCCCGG - Intronic
1034832588 7:154322151-154322173 GTGGACACATAACTTTAGCCAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038806777 8:30801118-30801140 GTGGGAAGACAGCTTGAGCTGGG + Intronic
1040815394 8:51502825-51502847 GTAGAAAGACAGCTTTCGCTTGG + Intronic
1040938669 8:52809522-52809544 GTGGACAGATTGCTTCAGCCTGG + Intergenic
1042337271 8:67641205-67641227 TTAAACAGACAGCTTTGGCTGGG + Intronic
1044097530 8:88086753-88086775 TTGAAGAGACAACTTTAGCTTGG - Intronic
1046151288 8:110229754-110229776 GTGGCCAGATGGCTTGAGCTTGG + Intergenic
1048328382 8:133455701-133455723 GTGTCCAGTCATCTTTAGCTGGG + Exonic
1050564453 9:6867518-6867540 ATGGGCAGACAGCTTTATATGGG + Intronic
1055455060 9:76464443-76464465 GTGGGCAGATCGCTTGAGCTCGG - Intronic
1055982339 9:82016678-82016700 GTGGGAAGATTGCTTTAGCTTGG - Intergenic
1059092313 9:111372801-111372823 GTGAGCAGATAGCTTGAGCTCGG + Intronic
1060277932 9:122196185-122196207 GTGGACAGACTGCTTGAGCCTGG - Intronic
1188496228 X:30785826-30785848 GTGGGCAGACCGCTTGAGCCCGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189554664 X:42129690-42129712 GTGGACAGAGAGCATTAGCTAGG + Intergenic
1192109107 X:68346032-68346054 GTGGGAAGATAGCTTGAGCTTGG + Intronic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1193613031 X:83655243-83655265 CTGGACAGAAAGCTTGAACTGGG - Intergenic
1194449710 X:94029351-94029373 GTGGAAAGATCGCTTGAGCTAGG + Intergenic
1194576541 X:95620437-95620459 GTGGGCAGACTGCTTGAGCCAGG - Intergenic
1194833154 X:98650257-98650279 GTGGCCAAACAGCTATGGCTAGG + Intergenic
1194833306 X:98652229-98652251 GGTGGCAGACAGCTTGAGCTGGG - Intergenic
1195482194 X:105358580-105358602 GTGGAAGGACTGCTTGAGCTGGG + Intronic
1197331804 X:125161860-125161882 CTGGAGATGCAGCTTTAGCTGGG - Intergenic
1198104941 X:133453319-133453341 GTGGACAGATCGCTTGAGTTGGG - Intergenic
1198381151 X:136084673-136084695 GTGGGAAGACTGCTTGAGCTTGG - Intergenic
1200310584 X:155072784-155072806 GTGGGCAGACTGCTTGAGCCAGG - Intronic
1200461458 Y:3459420-3459442 GTGGAGATACTGCTTTGGCTTGG + Intergenic
1202358328 Y:24075251-24075273 GTGGAGAGACGGCTTTAGAGTGG - Intergenic
1202512450 Y:25594862-25594884 GTGGAGAGACGGCTTTAGAGTGG + Intergenic