ID: 1017322464

View in Genome Browser
Species Human (GRCh38)
Location 6:153109871-153109893
Sequence ACCATGTTGGGCTTTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017322464 Original CRISPR ACCATGTTGGGCTTTGCCTC AGG (reversed) Intronic
900733460 1:4278986-4279008 ACCCTGTAGGGCTTTGACTTTGG + Intergenic
901097756 1:6695905-6695927 ACTATGTAGGGCTTTGCAGCTGG - Intronic
902644100 1:17786119-17786141 ACCATGCTGGGCTCTGCCTATGG - Intronic
902883526 1:19388752-19388774 ACAGTCTTGGGCTTTGCCTAAGG - Intronic
908926210 1:69258166-69258188 ACCATGTGGGGCCTTGCCCTTGG - Intergenic
913521927 1:119652756-119652778 ACCATCTTGGCCTCTGCCTAGGG - Intergenic
913992754 1:143630058-143630080 ATCCTGTGGGTCTTTGCCTCTGG - Intergenic
923807002 1:237268571-237268593 AAAATATTGGGCTTTGCCTGTGG + Intronic
1064014624 10:11762699-11762721 ACCATGCTGGGCTCTACGTCTGG + Intronic
1067066149 10:43105376-43105398 ACCCAGCTGGGCCTTGCCTCGGG + Intronic
1068835600 10:61548950-61548972 ACCATTTTGGGCTTTTCCTCTGG + Intergenic
1069500387 10:68947764-68947786 ACCATGCTATTCTTTGCCTCTGG - Intergenic
1071230837 10:83582619-83582641 AGCTTGTTGGTGTTTGCCTCTGG - Intergenic
1075420576 10:122297601-122297623 GCCATGTTGGTCTTGTCCTCTGG + Intronic
1079085298 11:17440723-17440745 ACCATGGTGTCCTATGCCTCAGG - Intronic
1079987191 11:27211799-27211821 ACCTTACTGGACTTTGCCTCTGG + Intergenic
1088888485 11:114026374-114026396 TCCCTGTTGGGCTTTGCTTTGGG - Intergenic
1097306189 12:58071767-58071789 ACAAGGTTGGCCTTTGACTCAGG + Intergenic
1097540329 12:60935261-60935283 AGGATGTTTGGCTTTGCTTCTGG + Intergenic
1103021149 12:117535303-117535325 AACATGTTGGGCTTTGAATGTGG + Intronic
1104706562 12:130951802-130951824 TCCATGTTTGGCTTTGCTGCGGG + Intergenic
1108203505 13:48064793-48064815 ACCATATGGGGCTTTGTGTCTGG + Intronic
1108642763 13:52397756-52397778 ACGATGTTGGGCTTGTCCACAGG + Exonic
1110500760 13:76225012-76225034 ACCAAGATGGACTTTACCTCAGG - Intergenic
1111970395 13:94908454-94908476 ACCATCTTGGGCATCTCCTCTGG + Intergenic
1112946413 13:104932716-104932738 AACATGTTGTATTTTGCCTCTGG - Intergenic
1114523188 14:23351782-23351804 TTCATCTTGGGCTTTGCCTCCGG - Exonic
1116431310 14:44848432-44848454 TCCATGTTGGGATTTGCCAGAGG - Intergenic
1121322860 14:93002704-93002726 ACCATCTTTGCCTTTCCCTCTGG - Intronic
1121408757 14:93734947-93734969 AGCCTGCTGGGCTTTGTCTCAGG - Intronic
1123927601 15:25133634-25133656 ACCATGTTGGGTCTGGCGTCAGG + Intergenic
1124348909 15:28941406-28941428 ACGATGTTTGGCTGTGCTTCAGG + Intronic
1126063439 15:44806187-44806209 ACCAAGCAGGGCTATGCCTCTGG + Intergenic
1138458989 16:57136979-57137001 ACCATGCTGGCCCTTCCCTCTGG + Intronic
1139064616 16:63297500-63297522 GCCATGTTGGCCTTAGCCTCAGG - Intergenic
1139592698 16:67942362-67942384 CCCATGCTGGTCTTGGCCTCAGG - Exonic
1140524715 16:75612995-75613017 ACACTGCTGGGCTCTGCCTCCGG - Intronic
1142468246 17:147919-147941 ACAATGATGGGCAGTGCCTCGGG - Intronic
1143547889 17:7610410-7610432 ACCATGTTAGGCTTGGCCCCAGG + Intronic
1148264566 17:46215258-46215280 ACCCTGTTGTTCTTTGCCTCTGG - Intronic
1148687105 17:49507142-49507164 TCCATGGTGGGTTTTGGCTCTGG + Intronic
1149239750 17:54635398-54635420 ACTAGGTAGGGCTTGGCCTCAGG - Intergenic
1149338908 17:55666457-55666479 ACAATGTTGGGATTTCCATCTGG - Intergenic
1152029208 17:77831197-77831219 ACCCTGCTGGGCTTTGACTGAGG - Intergenic
1152648210 17:81480032-81480054 GCCAGGTTGGGCTTAGCCCCAGG - Intergenic
1152686170 17:81694848-81694870 CCCATGCTGGGCCTTACCTCAGG - Exonic
1154092799 18:11380862-11380884 ACCAAATTGGGCTGTGCCTTTGG - Intergenic
1156398380 18:36718970-36718992 ACCATTTTTGTCTTTTCCTCAGG - Intronic
1161462031 19:4403167-4403189 ACCATGTTGGACCTTGCAGCGGG + Intronic
1166554627 19:43690015-43690037 ACAGTGTTGGGCTTGGCCTTGGG - Intergenic
1166690090 19:44817312-44817334 ACCAAGTTGGGGCCTGCCTCAGG - Intronic
1167302690 19:48687925-48687947 TCCCTCTTGGGCTTTGCCACTGG - Intergenic
1167871665 19:52375738-52375760 ACAATGTTTGGTTTTCCCTCAGG + Intronic
925217786 2:2111874-2111896 GCCATGGTGGGCGTTGCCCCCGG + Intronic
925315193 2:2917244-2917266 CCCACCTTGGGCTTTGTCTCAGG + Intergenic
927660135 2:24986358-24986380 CCCAAGTTTGGCTCTGCCTCGGG + Intergenic
929575682 2:43050317-43050339 CCCATCCTGGGCTCTGCCTCAGG - Intergenic
930072769 2:47381487-47381509 ACCATGTTTGGCTATCCATCTGG + Intronic
935341894 2:102065957-102065979 AGCACGTTGGACTCTGCCTCTGG - Intronic
937157890 2:119734165-119734187 CCCATGTTGGCCTCAGCCTCAGG + Intergenic
939249846 2:139669227-139669249 AGCATCTTGGGCATTGACTCAGG - Intergenic
939564902 2:143775432-143775454 TCCATGTTGGCCTCTGCCTGTGG - Intergenic
946412991 2:219524716-219524738 ACTAGGTTGGGCTTTCCATCTGG + Intronic
1169439469 20:5622202-5622224 ACAATGCTGGGCTTAGCCACTGG + Intergenic
1170593250 20:17787102-17787124 TGCATGTAGGGCTTTGTCTCAGG - Intergenic
1172997902 20:39084165-39084187 GCCCTGCTGGGCTTTGGCTCCGG - Intergenic
1176203844 20:63877478-63877500 ACCCTGGTGGGCTGTGTCTCGGG + Intronic
1178298990 21:31435877-31435899 ACCATGTGATGCTTTGCATCAGG + Intronic
1178382883 21:32125941-32125963 ACCATTTTTGGACTTGCCTCTGG - Intergenic
1179874476 21:44261213-44261235 TCCATGCTGGGCTCGGCCTCTGG + Exonic
1181907902 22:26213970-26213992 ACAATGTTGGGCTTGTCCTGTGG - Intronic
1182744471 22:32594969-32594991 ACTATGTTGGGCATTGTGTCTGG + Intronic
1183631158 22:39033561-39033583 CCCATGGTGGGCTTTCCCACAGG + Intergenic
1185393374 22:50574419-50574441 GCCATGCTGGGCCTTCCCTCAGG - Exonic
950989835 3:17421524-17421546 ACAAAGTTGGCCGTTGCCTCAGG - Intronic
952440965 3:33328679-33328701 TCCATTTTGGGTTTTGCATCTGG - Intronic
952523923 3:34189723-34189745 ACCAAGCAGGGCTATGCCTCTGG - Intergenic
953020649 3:39110923-39110945 ACTATGCTGGCCTTTTCCTCTGG + Exonic
953782130 3:45880591-45880613 AGCATGTTGGGCTTTGAGGCTGG - Intronic
963315557 3:143754711-143754733 ATCATCATGGGCTTTGTCTCAGG - Intronic
966298323 3:178449913-178449935 AGCATGCTGGGCTTTCCATCAGG - Intronic
966826115 3:183966479-183966501 ACCAAGTCAGGCTTTGCTTCTGG - Intronic
967977583 3:195044143-195044165 TCCAGGTTGGGCTTGGCCACTGG + Intergenic
969121369 4:4913826-4913848 GCCATGCTGGGATTTGACTCTGG + Intergenic
969923633 4:10564306-10564328 ACCATGTTGGGCCGAGACTCTGG + Intronic
971064584 4:23016163-23016185 ACCATGTAAGGCAGTGCCTCAGG + Intergenic
974712781 4:65622765-65622787 ATCTTGTTGGGCTTTACCTGTGG + Intronic
985812052 5:2097416-2097438 TCCATGGTGGGCTCTGCCGCAGG + Intergenic
988642823 5:33060276-33060298 AACATGTTGGTCTTTGACTTTGG - Intergenic
988914872 5:35882259-35882281 ACCAACTTGGCCTTAGCCTCAGG - Intergenic
990986076 5:61642108-61642130 CTCATCTTGGGTTTTGCCTCAGG - Intronic
999384844 5:151146766-151146788 ACTCTGTTGGGGTTTGCCTGAGG - Intronic
1000347557 5:160327585-160327607 ACCTTGTTGGGGGCTGCCTCTGG - Intronic
1005274034 6:24197635-24197657 ACCACGTTAGGCTTTTCATCAGG + Intronic
1008208041 6:48686978-48687000 GCCATGTGGGGCTTGGCCACAGG - Intergenic
1013558015 6:111276908-111276930 CCCTTATTGGGCCTTGCCTCAGG + Intergenic
1013558030 6:111276997-111277019 CCCTTATTGGGCCTTGCCTCAGG + Intergenic
1014824514 6:126033635-126033657 ACCAGGCTGGCCTTTTCCTCAGG - Intronic
1015585360 6:134770686-134770708 ACCATGGTTGGCTTTCCATCAGG + Intergenic
1016358982 6:143248000-143248022 CCCATATTGGGTTCTGCCTCTGG + Intronic
1017322464 6:153109871-153109893 ACCATGTTGGGCTTTGCCTCAGG - Intronic
1017819255 6:158037939-158037961 ACCAGGCTGGGCCTTGGCTCTGG + Intronic
1018355006 6:163004383-163004405 AACATGCTGGGGTTGGCCTCAGG + Intronic
1019042167 6:169116321-169116343 ACCAGGCTGGGCATTCCCTCAGG - Intergenic
1022991739 7:35715100-35715122 GCCATGTTGGGCTTTGACTCAGG + Intergenic
1024087983 7:45912572-45912594 ACCTTCTTGGGTTTGGCCTCCGG + Intronic
1025968932 7:66303970-66303992 AACCTCTGGGGCTTTGCCTCTGG - Intronic
1026517638 7:71086701-71086723 ACCAGGCTGGTCTTTCCCTCTGG - Intergenic
1028074166 7:86490693-86490715 ACAATATTGGGTATTGCCTCTGG + Intergenic
1029980114 7:104870758-104870780 AGCATGTTTGGATCTGCCTCAGG - Intronic
1030365968 7:108646214-108646236 ACCATGGTTGGCCTTGGCTCTGG - Intergenic
1031141275 7:117946323-117946345 AGCATGTGAGGTTTTGCCTCAGG - Intergenic
1032868681 7:135956443-135956465 ACCATGTTTTCCTTTTCCTCTGG + Intronic
1033604294 7:142914639-142914661 GTCATCTTGGGATTTGCCTCCGG - Exonic
1038777887 8:30547301-30547323 GGTGTGTTGGGCTTTGCCTCAGG - Exonic
1040531523 8:48270277-48270299 ACCATGTTGGGGTTTGCAGAGGG - Intergenic
1040578883 8:48678854-48678876 GCCATGTATGGATTTGCCTCCGG + Intergenic
1041785462 8:61628019-61628041 ACCATTTTTGGCTTAGCCTACGG + Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1045869024 8:106904344-106904366 CCCATTCTGGTCTTTGCCTCAGG - Intergenic
1046154383 8:110268083-110268105 ACCATGAGGGCCTTTGCCACTGG - Intergenic
1048473562 8:134723687-134723709 ACCATGGGGGGCTGAGCCTCTGG + Intergenic
1049310219 8:141930224-141930246 ACCAGGCTGAGCTCTGCCTCTGG - Intergenic
1049461933 8:142734303-142734325 GCCTTGGTGGCCTTTGCCTCTGG - Intronic
1052210955 9:25902707-25902729 AGCATCATGGGCTCTGCCTCAGG - Intergenic
1052734163 9:32323140-32323162 ACCATGTGAGCCTTTGTCTCAGG - Intergenic
1053461706 9:38276626-38276648 ACCATGAAGGGATTTGCATCTGG - Intergenic
1055456986 9:76481987-76482009 AGCATGCTGTGCTTTGCCCCAGG + Intronic
1055552959 9:77447798-77447820 GACATGGTGGACTTTGCCTCTGG + Intronic
1056030016 9:82543884-82543906 ACCATGGTGGCATTAGCCTCTGG - Intergenic
1198024560 X:132692593-132692615 TCCATGCTGGTCCTTGCCTCTGG + Intronic
1200920472 Y:8608592-8608614 ACCATCTTGGGATTTCACTCTGG + Intergenic