ID: 1017323619

View in Genome Browser
Species Human (GRCh38)
Location 6:153121225-153121247
Sequence TTGGTAAATACAGCCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017323619 Original CRISPR TTGGTAAATACAGCCTGTGT GGG (reversed) Intronic
901181945 1:7347897-7347919 TTTGGAAATACAGTCTTTGTGGG - Intronic
903255902 1:22099439-22099461 TTGGTATATGCAGCCAGAGTTGG + Intergenic
903712971 1:25339308-25339330 TTTGTAAAGACAGCTTGGGTCGG + Intronic
904545405 1:31266738-31266760 TTGGTAATGCCTGCCTGTGTTGG - Intronic
906054150 1:42901524-42901546 GTGGTAGCTACAGACTGTGTTGG + Intergenic
906931782 1:50177254-50177276 CTGGTAAATCCAGGCTATGTGGG + Intronic
907893979 1:58666188-58666210 ATGGCAAATACAGATTGTGTAGG - Intronic
911502850 1:98710286-98710308 TTGATGAATAAGGCCTGTGTAGG + Intronic
912143664 1:106763634-106763656 TTGGTAAATTTAGATTGTGTGGG - Intergenic
912548852 1:110471257-110471279 TTTGTAAATACAGTTTGTGCTGG - Intergenic
913208193 1:116561115-116561137 TTAGTAAATACAGGCTTTGAGGG - Intronic
913537175 1:119784219-119784241 TTGGAAAAATCAGGCTGTGTTGG - Intergenic
914907325 1:151757235-151757257 TTGGCAAAAACACTCTGTGTTGG - Intergenic
915790310 1:158662682-158662704 TTGGTTAGTACAGCCTGAGCAGG - Exonic
1064785869 10:18893617-18893639 TTGGTAAATACTTTCTGTGGAGG + Intergenic
1068435578 10:56986942-56986964 TTGGTAAATCCAGCCTGTCTAGG + Intergenic
1068476047 10:57527170-57527192 TTGGAAAATACATCATGAGTTGG - Intergenic
1068806332 10:61198014-61198036 TTGTTGACTACAGCCTGTATTGG - Intergenic
1072527448 10:96285957-96285979 TTTTTAAATCCAGCCTGAGTTGG - Intergenic
1072649793 10:97286014-97286036 TTTGTAAATAAGGCCTGTCTTGG - Intronic
1074797886 10:116967309-116967331 TTGGAAAGTACAGCTTTTGTGGG + Intronic
1076212487 10:128659541-128659563 TTGGATAATGCAGCCTGGGTAGG - Intergenic
1080329045 11:31114379-31114401 ATGGTAAATGCACCCTGTGTAGG + Intronic
1080875081 11:36267493-36267515 TTGGGAAATACAGTCTCTGCTGG - Intergenic
1084264204 11:67996582-67996604 TTGGTAAGTACAGCCTGCAAAGG - Exonic
1089633006 11:119795020-119795042 TTGGTACAAACATGCTGTGTAGG + Intergenic
1090339637 11:126005598-126005620 TTGGTAAATCCAGCATGACTGGG + Intronic
1095643765 12:44517830-44517852 TTGATAAATACACACCGTGTGGG - Intronic
1096944138 12:55385494-55385516 CTGCTATAAACAGCCTGTGTTGG + Intergenic
1102644791 12:114396839-114396861 TCTGTAAATTCAGCTTGTGTAGG - Intronic
1106470242 13:30047750-30047772 TTGCTGATTACAGCTTGTGTAGG - Intergenic
1111504694 13:89172290-89172312 TCGGAGAATACAGGCTGTGTAGG + Intergenic
1111843445 13:93478470-93478492 CTGGTAAATTATGCCTGTGTTGG - Intronic
1113385980 13:109848475-109848497 CTGGTAAATACAACCTCTATAGG - Intergenic
1118108686 14:62691534-62691556 TTTATAAATAATGCCTGTGTAGG - Intergenic
1118620985 14:67613707-67613729 TTGGCAAATACAGGCTGTAATGG - Intergenic
1119561933 14:75597519-75597541 TTGGTTAAGACAGTCTGTGTGGG - Intronic
1120617713 14:86728578-86728600 TCTGTAAATACAACCTGTATTGG - Intergenic
1121387439 14:93541390-93541412 TTGGTAAATTCAGCTTGCTTGGG - Intronic
1127389600 15:58494704-58494726 TTGCAAAATACAGCTTGGGTGGG + Intronic
1128479573 15:68025647-68025669 TTGGGAAATAGAGTCTCTGTAGG - Intergenic
1133792309 16:9018474-9018496 TTGGTAAATACAGCATATCCAGG + Intergenic
1134339978 16:13335902-13335924 AAGATAAATACAGCCTTTGTTGG + Intergenic
1137930727 16:52584784-52584806 TTTGCAATTAAAGCCTGTGTTGG - Intergenic
1139273453 16:65704893-65704915 TTGGAAGATACAGGCTCTGTGGG + Intergenic
1142307586 16:89294160-89294182 TTGGTGAAGAAAGCCTGAGTTGG + Intronic
1144054415 17:11526233-11526255 TTGGTAAATACTGCATGGGAGGG + Intronic
1151185797 17:72363093-72363115 TTGATAAATACAACCAGTGGGGG + Intergenic
1151446204 17:74165989-74166011 TTGTCAAATACAACCTGTGGTGG + Intergenic
1153525821 18:5993712-5993734 TTGGTTATTTCAGCCTATGTAGG + Intronic
1153775773 18:8452076-8452098 GTGGTAAAAACAGCCTGTCTAGG - Intergenic
1155027962 18:21959384-21959406 TTGGCAAATAGGGCCTGTCTAGG - Intergenic
1156178228 18:34572748-34572770 AAGGTAAATACAGCAGGTGTGGG - Intronic
1156701541 18:39831750-39831772 CTAGGAAATACAGCCTGTGGTGG - Intergenic
1157550108 18:48575575-48575597 TAGATAAATAAAGCCTGTGCTGG - Intronic
1158128117 18:54124228-54124250 TTGAGAAATACATCCTGTGCTGG + Intergenic
1164034142 19:21438329-21438351 ATGGTAAATACATCATTTGTAGG - Intronic
1166805967 19:45487373-45487395 TTGGTGATTCCAGCCTGTGAAGG + Intronic
1167521005 19:49955064-49955086 ATGGTAAACACAGCATTTGTAGG + Intronic
925917031 2:8614218-8614240 TTGTGAAATACTGCCTGTTTGGG + Intergenic
926428715 2:12764438-12764460 TTGGTAAAGTCATCCTGTGCTGG + Intergenic
927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG + Intronic
928284495 2:29977348-29977370 TTGGTAAACACAGCCCCTTTGGG + Intergenic
929755065 2:44757543-44757565 TTGGTAAATACAGACTATGGGGG + Intronic
933216173 2:79632960-79632982 TTTGTAAATATAGTCTGTATTGG - Intronic
933475586 2:82785875-82785897 TGAGTATATGCAGCCTGTGTTGG - Intergenic
933508567 2:83210361-83210383 TTGGTAAATAGGACCTGTGTTGG - Intergenic
935154792 2:100474466-100474488 TTGTTAACTGCAGCCTGTGAAGG - Intronic
939825386 2:147009304-147009326 TTGGGAAATCAAGACTGTGTTGG + Intergenic
946536376 2:220634126-220634148 TGGGTAAGTACAGCCCGTGGTGG + Intergenic
946850177 2:223898208-223898230 TTGGGAAACATACCCTGTGTAGG - Intronic
1170328397 20:15181169-15181191 ATCGAAAATACAGTCTGTGTAGG - Intronic
1170925257 20:20717200-20717222 TTTAAAAATACAGCATGTGTTGG + Intergenic
1172306421 20:33884008-33884030 TTTGTATATAAAGCATGTGTGGG - Intergenic
1173321770 20:41993800-41993822 CTGGAAAATGCAGCCTGTATGGG + Intergenic
1177122752 21:17158232-17158254 ATGGAAAATACAGCCTTCGTGGG + Intergenic
1177475177 21:21611279-21611301 TTGGGGACTACAGCCTGTCTTGG + Intergenic
1178788683 21:35677755-35677777 TAGGTAAATACACCCTGAGGTGG + Intronic
1179121998 21:38556555-38556577 CTGGTAAATATAGTCTGTCTGGG - Intronic
1182529633 22:30945179-30945201 TAGGAAAATATAGCCTGGGTTGG - Intronic
1185418611 22:50722789-50722811 ATGGTAAAGACAGCCTGTGTCGG - Intergenic
949151825 3:778300-778322 GTGTTAGATACAGCCTGTGGAGG - Intergenic
949501957 3:4688486-4688508 TTGGTATCTTCGGCCTGTGTGGG - Exonic
949834609 3:8254391-8254413 TTTGTAATTACTGCCTCTGTAGG + Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
954944595 3:54409354-54409376 TTGATAAATATTGCATGTGTTGG + Intronic
954989977 3:54832307-54832329 CTGGTTAACACAGCCTGGGTTGG + Intronic
957072110 3:75575574-75575596 TTGGTCAAAACACCCTGTCTTGG + Intergenic
958094360 3:88923207-88923229 TTCTTAAATACAGCCTCTGCAGG - Intergenic
958539873 3:95457557-95457579 TTGGTAATTAAAGCCACTGTAGG - Intergenic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
962635673 3:137329103-137329125 TGTGTAGACACAGCCTGTGTAGG + Intergenic
963453949 3:145519972-145519994 TTAGTAATTAGAGCATGTGTAGG - Intergenic
965260517 3:166478127-166478149 TTGGTGAATACTGCCTGGGTTGG - Intergenic
970200990 4:13605203-13605225 TTCTTACAAACAGCCTGTGTAGG + Intronic
970791015 4:19857698-19857720 CTGGTAAATATAGACTGTCTGGG + Intergenic
975859289 4:78659124-78659146 TTGGAAAATAAAGATTGTGTGGG + Intergenic
977718672 4:100212801-100212823 TTGGTTACCACAGCTTGTGTGGG + Intergenic
978922406 4:114200561-114200583 TTGGTAAATGCTGCCTGGCTTGG + Intergenic
987127695 5:14830334-14830356 TCGGTCATTCCAGCCTGTGTGGG - Intronic
989451693 5:41594050-41594072 TTAGTAAATTCAGGCTGTTTAGG - Intergenic
996390896 5:122960019-122960041 GTGGAAAACACAGCCCGTGTAGG - Intronic
997737732 5:136226510-136226532 TTGGTAAATATACCCAGTGGAGG - Intronic
1000174445 5:158737196-158737218 TTGGTTAATTCTGCCTATGTTGG - Intronic
1000176777 5:158763828-158763850 TAAGCAAATACATCCTGTGTTGG + Intronic
1003490139 6:6614036-6614058 TTGTTATTTACAGCCTGTATTGG + Intronic
1004503554 6:16229545-16229567 ATGGTAAACACAGCATTTGTAGG - Intergenic
1006893051 6:37446322-37446344 TGGGTAAATACAGCCAGGGTCGG + Exonic
1007190452 6:40012077-40012099 TTGGTAAATGCTCCCTCTGTGGG + Intergenic
1007833920 6:44659769-44659791 GTGCTAAATTCAGTCTGTGTGGG + Intergenic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1010507516 6:76678525-76678547 TTAATAAATAGAACCTGTGTAGG - Intergenic
1011769059 6:90655297-90655319 TTGGTATATACAACATATGTTGG - Intergenic
1012023192 6:93952365-93952387 TGGGTAAGTACACTCTGTGTAGG + Intergenic
1012677401 6:102134374-102134396 GTGGAAAATACAGTCTGTTTTGG + Intergenic
1012989376 6:105909529-105909551 TTAGTAAATACAGCCTCTGTTGG + Intergenic
1015343789 6:132131952-132131974 TTCTTAATCACAGCCTGTGTGGG + Intergenic
1015832212 6:137382978-137383000 TTGGTCAATATCGCCTGTGCTGG - Intergenic
1017323619 6:153121225-153121247 TTGGTAAATACAGCCTGTGTGGG - Intronic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1020850844 7:13350674-13350696 TTGATAAATACAGAATGTGATGG + Intergenic
1021569317 7:22048436-22048458 TTGCCAAATACAGCCAATGTGGG + Intergenic
1026425813 7:70292269-70292291 ATGTTAACTAAAGCCTGTGTGGG - Intronic
1030916816 7:115325257-115325279 TTGTTAATTACAGACTGTATTGG + Intergenic
1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG + Intergenic
1040314801 8:46255257-46255279 TTGGTAATTACAGCCCATCTGGG - Intergenic
1043478566 8:80629240-80629262 ACTGTAAATACAGCCTGTGGAGG - Exonic
1046200671 8:110923881-110923903 TTGTTAGAAATAGCCTGTGTTGG - Intergenic
1049216336 8:141410021-141410043 TGGGGACATACAGCCTGGGTCGG + Intronic
1051865883 9:21681899-21681921 TCAGTAAAGACAGCCTATGTAGG - Intergenic
1055042355 9:71888751-71888773 TTGGTAAATAAGGGTTGTGTGGG - Intronic
1057838804 9:98468406-98468428 TTGACAAATACAACCTGTGCAGG + Intronic
1057839025 9:98470141-98470163 TTGATAAATACAACCTGTGCAGG + Intronic
1060325861 9:122615015-122615037 TTGGGCTAAACAGCCTGTGTAGG - Exonic
1186680767 X:11871224-11871246 TTGGTTAATGCACTCTGTGTTGG + Intergenic
1186776104 X:12866058-12866080 TTGGTTTTTACTGCCTGTGTGGG + Intergenic