ID: 1017329297

View in Genome Browser
Species Human (GRCh38)
Location 6:153177009-153177031
Sequence AACCCAATGCTTGTACCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017329296_1017329297 -4 Left 1017329296 6:153176990-153177012 CCTTAAGGACTGTGTAGTCAACC No data
Right 1017329297 6:153177009-153177031 AACCCAATGCTTGTACCAATTGG No data
1017329295_1017329297 7 Left 1017329295 6:153176979-153177001 CCTTTTCATATCCTTAAGGACTG No data
Right 1017329297 6:153177009-153177031 AACCCAATGCTTGTACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017329297 Original CRISPR AACCCAATGCTTGTACCAAT TGG Intergenic
No off target data available for this crispr