ID: 1017335781

View in Genome Browser
Species Human (GRCh38)
Location 6:153258140-153258162
Sequence AATCCATCCAGTTTCAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017335781_1017335785 28 Left 1017335781 6:153258140-153258162 CCTACATTGAAACTGGATGGATT No data
Right 1017335785 6:153258191-153258213 CCAACTAGAATGCAAGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017335781 Original CRISPR AATCCATCCAGTTTCAATGT AGG (reversed) Intergenic
No off target data available for this crispr