ID: 1017345258

View in Genome Browser
Species Human (GRCh38)
Location 6:153372146-153372168
Sequence TATAGGCATGAGCCACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017345258_1017345270 25 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345270 6:153372194-153372216 TGGGTGGATCACCTGAGGTCAGG 0: 15131
1: 42916
2: 78223
3: 96454
4: 105535
1017345258_1017345269 20 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345269 6:153372189-153372211 CTAGGTGGGTGGATCACCTGAGG 0: 199
1: 11362
2: 36911
3: 70076
4: 89750
1017345258_1017345266 6 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345266 6:153372175-153372197 GCACTTTGAGAGGCCTAGGTGGG 0: 38
1: 3941
2: 79995
3: 258073
4: 247176
1017345258_1017345265 5 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345265 6:153372174-153372196 GGCACTTTGAGAGGCCTAGGTGG No data
1017345258_1017345261 -4 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345261 6:153372165-153372187 TATAATCCCGGCACTTTGAGAGG 0: 16
1: 1704
2: 43535
3: 341669
4: 254966
1017345258_1017345263 2 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345263 6:153372171-153372193 CCCGGCACTTTGAGAGGCCTAGG No data
1017345258_1017345267 9 Left 1017345258 6:153372146-153372168 CCAGGTGGTGGCTCATGCCTATA No data
Right 1017345267 6:153372178-153372200 CTTTGAGAGGCCTAGGTGGGTGG 0: 29
1: 2953
2: 57157
3: 141878
4: 178146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017345258 Original CRISPR TATAGGCATGAGCCACCACC TGG (reversed) Intergenic
No off target data available for this crispr