ID: 1017349523

View in Genome Browser
Species Human (GRCh38)
Location 6:153423254-153423276
Sequence CTGTCAGTAAGAAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017349523_1017349526 -8 Left 1017349523 6:153423254-153423276 CCATCTTCCTTTCTTACTGACAG No data
Right 1017349526 6:153423269-153423291 ACTGACAGCTTTATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017349523 Original CRISPR CTGTCAGTAAGAAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr