ID: 1017353949

View in Genome Browser
Species Human (GRCh38)
Location 6:153480071-153480093
Sequence CTGACTTTAAGGAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017353949_1017353953 3 Left 1017353949 6:153480071-153480093 CCAGTTTCCCTCCTTAAAGTCAG No data
Right 1017353953 6:153480097-153480119 TGTACATTCTTTGATTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017353949 Original CRISPR CTGACTTTAAGGAGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr