ID: 1017359002

View in Genome Browser
Species Human (GRCh38)
Location 6:153543660-153543682
Sequence AAGAAAGACTAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017359002_1017359007 15 Left 1017359002 6:153543660-153543682 CCCACTTCCCTCTAGTCTTTCTT No data
Right 1017359007 6:153543698-153543720 AGAGAAAAATAATATCAAAAGGG No data
1017359002_1017359006 14 Left 1017359002 6:153543660-153543682 CCCACTTCCCTCTAGTCTTTCTT No data
Right 1017359006 6:153543697-153543719 GAGAGAAAAATAATATCAAAAGG No data
1017359002_1017359009 30 Left 1017359002 6:153543660-153543682 CCCACTTCCCTCTAGTCTTTCTT No data
Right 1017359009 6:153543713-153543735 CAAAAGGGGCCAGAGTTTCAAGG No data
1017359002_1017359008 16 Left 1017359002 6:153543660-153543682 CCCACTTCCCTCTAGTCTTTCTT No data
Right 1017359008 6:153543699-153543721 GAGAAAAATAATATCAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017359002 Original CRISPR AAGAAAGACTAGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr