ID: 1017367035

View in Genome Browser
Species Human (GRCh38)
Location 6:153655139-153655161
Sequence CAGTGTAAAAAGGTGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017367035_1017367042 4 Left 1017367035 6:153655139-153655161 CCCCCATCCACCTTTTTACACTG No data
Right 1017367042 6:153655166-153655188 TGAAGCATTACTGAAGCCCAGGG No data
1017367035_1017367045 27 Left 1017367035 6:153655139-153655161 CCCCCATCCACCTTTTTACACTG No data
Right 1017367045 6:153655189-153655211 TTCTAATCTGTGATGTGCCATGG No data
1017367035_1017367041 3 Left 1017367035 6:153655139-153655161 CCCCCATCCACCTTTTTACACTG No data
Right 1017367041 6:153655165-153655187 TTGAAGCATTACTGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017367035 Original CRISPR CAGTGTAAAAAGGTGGATGG GGG (reversed) Intergenic
No off target data available for this crispr