ID: 1017371107

View in Genome Browser
Species Human (GRCh38)
Location 6:153710164-153710186
Sequence CACACGCACATGCATGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017371104_1017371107 11 Left 1017371104 6:153710130-153710152 CCCTGGAATCCTTACACATACAC No data
Right 1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG No data
1017371106_1017371107 2 Left 1017371106 6:153710139-153710161 CCTTACACATACACGTACACATA No data
Right 1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG No data
1017371102_1017371107 24 Left 1017371102 6:153710117-153710139 CCCAAGAGAACTGCCCTGGAATC No data
Right 1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG No data
1017371105_1017371107 10 Left 1017371105 6:153710131-153710153 CCTGGAATCCTTACACATACACG No data
Right 1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG No data
1017371103_1017371107 23 Left 1017371103 6:153710118-153710140 CCAAGAGAACTGCCCTGGAATCC No data
Right 1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017371107 Original CRISPR CACACGCACATGCATGCACA TGG Intergenic
No off target data available for this crispr