ID: 1017371467

View in Genome Browser
Species Human (GRCh38)
Location 6:153714221-153714243
Sequence TGCACTGTGCCCTCACATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017371463_1017371467 0 Left 1017371463 6:153714198-153714220 CCTGGTTCTTAGAACAATGCATT No data
Right 1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG No data
1017371462_1017371467 6 Left 1017371462 6:153714192-153714214 CCACTTCCTGGTTCTTAGAACAA No data
Right 1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG No data
1017371461_1017371467 7 Left 1017371461 6:153714191-153714213 CCCACTTCCTGGTTCTTAGAACA No data
Right 1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017371467 Original CRISPR TGCACTGTGCCCTCACATGG GGG Intergenic
No off target data available for this crispr