ID: 1017373219

View in Genome Browser
Species Human (GRCh38)
Location 6:153736989-153737011
Sequence CGCTATTGCAAGAGAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017373218_1017373219 2 Left 1017373218 6:153736964-153736986 CCAGATTAAACAAAGAAGACTTC No data
Right 1017373219 6:153736989-153737011 CGCTATTGCAAGAGAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017373219 Original CRISPR CGCTATTGCAAGAGAGAAGA CGG Intergenic
No off target data available for this crispr