ID: 1017375274

View in Genome Browser
Species Human (GRCh38)
Location 6:153761171-153761193
Sequence ACATTCCCACAGATGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017375273_1017375274 -6 Left 1017375273 6:153761154-153761176 CCTTATTTGGAACATCAACATTC No data
Right 1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG No data
1017375272_1017375274 -3 Left 1017375272 6:153761151-153761173 CCACCTTATTTGGAACATCAACA No data
Right 1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017375274 Original CRISPR ACATTCCCACAGATGAAAAG AGG Intergenic
No off target data available for this crispr