ID: 1017376020

View in Genome Browser
Species Human (GRCh38)
Location 6:153769029-153769051
Sequence TTTCCATGACACTCCAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017376018_1017376020 -6 Left 1017376018 6:153769012-153769034 CCATGGCAACTTGTGGCTTTCCA No data
Right 1017376020 6:153769029-153769051 TTTCCATGACACTCCAATAAGGG No data
1017376015_1017376020 20 Left 1017376015 6:153768986-153769008 CCGATTCTCTCATCTCAGACTAA No data
Right 1017376020 6:153769029-153769051 TTTCCATGACACTCCAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017376020 Original CRISPR TTTCCATGACACTCCAATAA GGG Intergenic
No off target data available for this crispr