ID: 1017377341

View in Genome Browser
Species Human (GRCh38)
Location 6:153786616-153786638
Sequence CAGGGTACTAAAGTTATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017377341_1017377343 -10 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377343 6:153786629-153786651 TAGTACCCTGGAGCCACTGAAGG No data
1017377341_1017377350 6 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377350 6:153786645-153786667 CTGAAGGGAGAGTGGTGGCCAGG No data
1017377341_1017377353 26 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377353 6:153786665-153786687 AGGCTGCTTCATACTGGTTAAGG No data
1017377341_1017377347 -2 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377347 6:153786637-153786659 TGGAGCCACTGAAGGGAGAGTGG No data
1017377341_1017377351 20 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377351 6:153786659-153786681 GTGGCCAGGCTGCTTCATACTGG No data
1017377341_1017377344 -9 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377344 6:153786630-153786652 AGTACCCTGGAGCCACTGAAGGG No data
1017377341_1017377348 1 Left 1017377341 6:153786616-153786638 CCTGCAATAACTTTAGTACCCTG No data
Right 1017377348 6:153786640-153786662 AGCCACTGAAGGGAGAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017377341 Original CRISPR CAGGGTACTAAAGTTATTGC AGG (reversed) Intergenic
No off target data available for this crispr