ID: 1017384164

View in Genome Browser
Species Human (GRCh38)
Location 6:153863086-153863108
Sequence CAGCAGATGTCTTACAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017384159_1017384164 1 Left 1017384159 6:153863062-153863084 CCCCACCAGACTAAACAGATTTC No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data
1017384157_1017384164 24 Left 1017384157 6:153863039-153863061 CCTCCAGACACTTATAAGAGAAT No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data
1017384158_1017384164 21 Left 1017384158 6:153863042-153863064 CCAGACACTTATAAGAGAATCCC No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data
1017384161_1017384164 -1 Left 1017384161 6:153863064-153863086 CCACCAGACTAAACAGATTTCTC No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data
1017384160_1017384164 0 Left 1017384160 6:153863063-153863085 CCCACCAGACTAAACAGATTTCT No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data
1017384162_1017384164 -4 Left 1017384162 6:153863067-153863089 CCAGACTAAACAGATTTCTCAGC No data
Right 1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017384164 Original CRISPR CAGCAGATGTCTTACAGGCC AGG Intergenic
No off target data available for this crispr