ID: 1017386442

View in Genome Browser
Species Human (GRCh38)
Location 6:153890225-153890247
Sequence ATGCCCACCCAGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017386442_1017386447 19 Left 1017386442 6:153890225-153890247 CCTTCACCCTTCTGGGTGGGCAT No data
Right 1017386447 6:153890267-153890289 TCTATGGTTTGCATTAAATGAGG No data
1017386442_1017386446 3 Left 1017386442 6:153890225-153890247 CCTTCACCCTTCTGGGTGGGCAT No data
Right 1017386446 6:153890251-153890273 TTGTTAGGTCTCTTTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017386442 Original CRISPR ATGCCCACCCAGAAGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr