ID: 1017395123

View in Genome Browser
Species Human (GRCh38)
Location 6:153990006-153990028
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017395123_1017395127 16 Left 1017395123 6:153990006-153990028 CCTTCAACCTTCTGCCTATATAG No data
Right 1017395127 6:153990045-153990067 CTGATCAATGTCTCATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017395123 Original CRISPR CTATATAGGCAGAAGGTTGA AGG (reversed) Intergenic
No off target data available for this crispr