ID: 1017402528

View in Genome Browser
Species Human (GRCh38)
Location 6:154080663-154080685
Sequence AATCATGTGAGCAGATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017402528_1017402533 20 Left 1017402528 6:154080663-154080685 CCATCCCATCTGCTCACATGATT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 1017402533 6:154080706-154080728 GACCCGTACGTGAGTGGCTCCGG No data
1017402528_1017402532 14 Left 1017402528 6:154080663-154080685 CCATCCCATCTGCTCACATGATT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data
1017402528_1017402531 -4 Left 1017402528 6:154080663-154080685 CCATCCCATCTGCTCACATGATT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 1017402531 6:154080682-154080704 GATTAGAATCATCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402528 Original CRISPR AATCATGTGAGCAGATGGGA TGG (reversed) Intronic
902814443 1:18908128-18908150 AATCAGAGGAGCAGGTGGGACGG + Exonic
903769367 1:25754244-25754266 AATCACTTCAGGAGATGGGATGG - Intronic
906092105 1:43188919-43188941 ATTCATTTGAGTATATGGGATGG + Intronic
906102870 1:43274222-43274244 TAGCATGTGAGCAAATGCGAAGG - Intergenic
906484349 1:46222697-46222719 AATCATTTGAGGGGGTGGGAGGG - Intergenic
907887529 1:58607072-58607094 AATGGAGTGAGCAGATGGGGAGG - Intergenic
908510225 1:64845312-64845334 ACTCATGTGAGCACAGGGAACGG + Intronic
908610002 1:65847442-65847464 AAACATATGAGCAGATTGGATGG + Intronic
909277025 1:73699771-73699793 CTTCATGTCACCAGATGGGATGG + Intergenic
910509856 1:87991608-87991630 ATTGATTTGAGCAGAGGGGATGG + Intergenic
911044921 1:93620409-93620431 GATCATGTGAGCAGATGCTGTGG - Intronic
911636422 1:100240615-100240637 AAAAATGTGGGGAGATGGGAAGG + Intronic
911846221 1:102754486-102754508 AATCATTTAAACAGATGTGAGGG - Intergenic
912043575 1:105422535-105422557 AATTATGTGAGGAGATGGATGGG + Intergenic
912210198 1:107548681-107548703 AATGATGAGAGCGGAAGGGAAGG - Intergenic
913646863 1:120865255-120865277 AAGAATGTCAGCATATGGGATGG - Intergenic
914079784 1:144397608-144397630 AAGAATGTCAGCATATGGGATGG + Intergenic
914174685 1:145266146-145266168 AAGAATGTCAGCATATGGGATGG + Intergenic
914529413 1:148507634-148507656 AAGAATGTCAGCATATGGGATGG + Intergenic
914676195 1:149909175-149909197 ATTCAGGTGAGGAGATGGGTGGG - Exonic
915137370 1:153742415-153742437 AAAGATGAGAGTAGATGGGATGG + Intronic
915689630 1:157675836-157675858 AGTCATGAAAGCAGCTGGGATGG + Intronic
916722893 1:167498178-167498200 AGAAATGTGAGCAGATGGGCAGG - Intronic
918324392 1:183395680-183395702 AATAATGTGACCATATGGTAAGG - Intronic
919782372 1:201229208-201229230 AATCCTGTGAGCAGCAGGGCTGG + Intergenic
923135814 1:231117743-231117765 AATACTGTGAGCAAATGGGGTGG + Intergenic
923848419 1:237764341-237764363 AAGAATATGAACAGATGGGAGGG - Intronic
1063849015 10:10163262-10163284 ATTCATTAGAGCTGATGGGAAGG + Intergenic
1063925647 10:10974634-10974656 AATCACGTAACCAGAGGGGATGG - Intergenic
1066191471 10:33059867-33059889 AATCAGGTGGGAAGATGGGAGGG - Intergenic
1068456001 10:57254836-57254858 AATGATGTAAGTATATGGGAAGG - Intergenic
1068773643 10:60849208-60849230 AATCATTTGATCAGGTTGGAAGG + Intergenic
1070513502 10:77182466-77182488 TATCATGTGTGCACATGTGAAGG + Intronic
1071154811 10:82676188-82676210 AAGCATGTGAACAGAAGGGCTGG - Intronic
1072871597 10:99126028-99126050 GACAGTGTGAGCAGATGGGAGGG + Intronic
1073420552 10:103420697-103420719 AAAAATGGGAGCAGAGGGGAGGG + Intronic
1073526800 10:104190487-104190509 AATCATGGTAGCTGATGAGATGG - Intronic
1074260538 10:111848894-111848916 ACCCATGAGAGCAGCTGGGAGGG + Intergenic
1074402729 10:113155322-113155344 ACTCAGGTGAGCAAATGGCATGG - Intronic
1074460865 10:113635805-113635827 AACCAGGTGAGCATAAGGGAAGG - Intronic
1074480952 10:113820209-113820231 AAAGATGTGAGCAGAAGAGATGG - Intergenic
1076001278 10:126915000-126915022 GAAAATGTGAGCAGAAGGGATGG - Intronic
1076203389 10:128575893-128575915 AACTATGTGAGCAGAGGAGAAGG - Intergenic
1077502792 11:2916880-2916902 TATGATGTCAGCAGCTGGGAAGG - Intronic
1078989920 11:16636171-16636193 AGTCATGAAAGCAGCTGGGAGGG + Intronic
1079098563 11:17526800-17526822 CATCAGGAGAGCTGATGGGAAGG + Exonic
1079389584 11:20009906-20009928 CATCATGGGAGCAAATAGGAGGG - Intronic
1080550176 11:33367579-33367601 AAGCATGTAAGTATATGGGAAGG - Intergenic
1080948355 11:37000074-37000096 AATCACGTGAGCCCAGGGGACGG + Intergenic
1081501916 11:43675469-43675491 AATCAAGTGAGCACAGGAGAGGG + Intronic
1085107648 11:73859566-73859588 AATCAAGTGACCAGATGTGGTGG - Intronic
1087678643 11:101192445-101192467 AATGAAATGTGCAGATGGGAGGG + Intergenic
1087798397 11:102478242-102478264 GATCCTCTGAGCAGATGGTAGGG - Intronic
1088798928 11:113287984-113288006 AACCGTGAAAGCAGATGGGAGGG + Intergenic
1089450877 11:118595665-118595687 AATCATGAGGGCTGATGGGTAGG - Intronic
1092872077 12:12814153-12814175 AAGCTTGTGACCAGTTGGGATGG + Exonic
1095321552 12:40834441-40834463 AGTCATGATAGCAGATGGAAGGG + Intronic
1096720884 12:53520822-53520844 AGTGATGAGAGCAGATGGGATGG - Intronic
1097718963 12:62999804-62999826 CATCAACTGAGCAGATGGAAGGG + Intergenic
1099095370 12:78369258-78369280 AATCAAGTGACCAAATAGGAGGG - Intergenic
1099868725 12:88319281-88319303 AATAATGTGAGCAATTGAGAAGG - Intergenic
1100077017 12:90797527-90797549 AAGCATGTGAGCATACTGGAAGG - Intergenic
1100775501 12:97968847-97968869 ATTGATGTGGGCAGATGGGTTGG - Intergenic
1102570722 12:113825541-113825563 ACTCATATTAGCAGATGGGAGGG - Intronic
1103314122 12:120038527-120038549 TTTAATGTGAGCAGGTGGGATGG - Intronic
1104080017 12:125421688-125421710 AACCATTTGAGCAGAGGGAAAGG + Intronic
1105440152 13:20408234-20408256 AAGCAGGTGAGCTGATGGGCGGG - Intronic
1106013814 13:25849289-25849311 AATCATGAAAACAGATGGGCTGG - Intronic
1106326796 13:28698991-28699013 AACCATGCAAGCTGATGGGATGG - Intergenic
1107354653 13:39553948-39553970 AAGCTTGTGAGCTGATGGGTTGG - Intronic
1108507929 13:51129419-51129441 AAACTTGAGAGCTGATGGGATGG + Intergenic
1108748295 13:53418746-53418768 ATTCATCTGAGAAGATGTGATGG + Intergenic
1112439666 13:99416558-99416580 TTTCCTGAGAGCAGATGGGATGG - Intergenic
1113208255 13:107942183-107942205 AATGATGTCAGCAGTTGTGATGG + Intergenic
1113710444 13:112461078-112461100 GATCTCGTGAGGAGATGGGACGG - Intergenic
1115895501 14:38082227-38082249 AAACATGACAGCAGATGGGCAGG + Intergenic
1120028644 14:79614785-79614807 AGTCATGTGAGTAGATGCTAGGG - Intronic
1121501519 14:94442070-94442092 AAGCAGGTGTGCAGATGGGCCGG - Intergenic
1122388212 14:101363068-101363090 ATTCCTGTGAGAAGCTGGGATGG - Intergenic
1122989266 14:105229357-105229379 GATCATGTGTGCAGATGGAACGG + Intronic
1125507047 15:40272994-40273016 AGTCAGGTGGGCAGCTGGGAGGG + Exonic
1126734057 15:51713958-51713980 AAGGAGGTGAGAAGATGGGATGG + Intronic
1127551517 15:60043478-60043500 CAACATGTGGGCAGATGGGTGGG - Intronic
1127932745 15:63607859-63607881 CATCTTGAGAGCAGCTGGGAGGG - Intergenic
1130644024 15:85707717-85707739 ACTCAAGTGATCTGATGGGAAGG - Intronic
1130907600 15:88251552-88251574 ACCCATGGGAGCACATGGGATGG + Intronic
1132168716 15:99624474-99624496 AATCATTTGACCATATGTGAGGG + Intronic
1132837518 16:1961714-1961736 AGTCAAGTGAGCACAAGGGAGGG - Intronic
1135042850 16:19131156-19131178 CATCCTTTCAGCAGATGGGAAGG + Intronic
1136600949 16:31288008-31288030 AGTTATGAGAGCAAATGGGAGGG + Intronic
1138246633 16:55471389-55471411 ATACATATGAGCAGATGGAAGGG - Intronic
1139085456 16:63579900-63579922 AATCATGGCAGCAGATGGCTTGG + Intergenic
1139436748 16:66940937-66940959 AATCATCTAGGCGGATGGGATGG + Intronic
1139531797 16:67546091-67546113 GCTCAGGGGAGCAGATGGGAGGG - Intronic
1139686142 16:68605170-68605192 AATCTGGTGGGCAGAGGGGAGGG - Intergenic
1140031072 16:71339847-71339869 AACCATGAGAGCAGATGTGTGGG + Intergenic
1143179253 17:4973990-4974012 ACTAATCTGAGCTGATGGGAAGG - Intronic
1144829518 17:18123432-18123454 AAGCACGTGGGCAGATGGGTGGG + Intronic
1149488354 17:57063294-57063316 AGTCATGAGAACAGATGGGTGGG + Intergenic
1152228446 17:79103251-79103273 AACCCTGTGAGCAGAGGAGAGGG + Exonic
1153146744 18:2041679-2041701 AATCATGAGAGACAATGGGAAGG + Intergenic
1153453025 18:5250624-5250646 AATGATGTGATAAGATGAGAAGG + Intergenic
1158134690 18:54194002-54194024 AATCATGTGAGATCATTGGAAGG - Intronic
1158866076 18:61638851-61638873 AGTCATGTGAGCTGTTGGTAGGG - Intergenic
1160717785 19:584215-584237 AATCAGATGGGAAGATGGGAAGG + Intergenic
1163567403 19:18059672-18059694 AATCATGTGAGTGGATGGAATGG + Intronic
1167330609 19:48853665-48853687 ACTCAGGTGAGCACCTGGGAAGG - Exonic
925548516 2:5043412-5043434 AAGGATGGGAGCAGGTGGGAAGG - Intergenic
925808423 2:7674779-7674801 CATCATGAGAGCAGATGGTATGG + Intergenic
925952067 2:8924162-8924184 AATCTTGTGTGAAGATGGCATGG - Intronic
926839330 2:17061243-17061265 CAACATGTGAGCAGTTGGAAGGG + Intergenic
926914050 2:17876810-17876832 GAACATGTGAGCAGTCGGGAAGG - Intergenic
928837033 2:35559401-35559423 AAACATGAAAGCAGCTGGGAGGG + Intergenic
928938770 2:36706881-36706903 AACCATGTGAGGAGTTGGCAGGG + Intronic
929824956 2:45302779-45302801 AATCATCCGGGCAGGTGGGAAGG - Intergenic
934961070 2:98673624-98673646 AGTCATGTAAACAAATGGGATGG + Intronic
937716665 2:125039812-125039834 AGTCTTATGAGCAGATGGGGAGG - Intergenic
937895536 2:126974475-126974497 AAACCTGTGACTAGATGGGATGG - Intergenic
940581444 2:155585011-155585033 AAGCCAGGGAGCAGATGGGAGGG - Intergenic
942192659 2:173485779-173485801 AATACTGCGAGCAGATGGGGTGG + Intergenic
943484009 2:188456803-188456825 ACTCATGAAAGCAGATGGGAGGG + Intronic
944315793 2:198284516-198284538 TAGCATGTGAGCAGATATGACGG - Intronic
947289353 2:228554810-228554832 AATGATGTGAGAAGATGATAGGG - Intergenic
947637716 2:231688588-231688610 AATTATGGGAGCAACTGGGAAGG - Intergenic
947911649 2:233804588-233804610 AAAGATGGGAGCAGATGGAAAGG + Intronic
1171242972 20:23586412-23586434 AAGCAGGTGAGCATCTGGGAGGG - Intergenic
1171865858 20:30487268-30487290 AATCTTGGGAGCAGGTGGGCTGG - Intergenic
1172705123 20:36877542-36877564 AAGCTTGGGAGCAGAGGGGAAGG - Intronic
1174663885 20:52239086-52239108 AATGGGGTGGGCAGATGGGATGG - Intergenic
1175723416 20:61300967-61300989 GCTCATGTGAGGAGGTGGGAGGG - Intronic
1175765764 20:61591523-61591545 ACTCAGGTGTGTAGATGGGAAGG + Intronic
1176982802 21:15402625-15402647 AATGATTTGAGCAGAAGTGATGG + Intergenic
1177238780 21:18428959-18428981 ACTCATGAAAGCAGCTGGGAGGG + Intronic
1178433563 21:32537323-32537345 GATCATGAGAGAAGATGGGTTGG + Intergenic
1183549635 22:38474336-38474358 ACTCAAGTGATCCGATGGGAAGG + Intronic
1185096513 22:48808913-48808935 CATGATGTGAGCAGATGTGGAGG + Intronic
1185149531 22:49156132-49156154 AATCATGTGTGCAGAGTGGGAGG - Intergenic
1185249363 22:49791824-49791846 TTTCCTGTGAGCTGATGGGAAGG - Intronic
951249844 3:20382008-20382030 AATCTTGAGAGCTGATGGGATGG + Intergenic
952242711 3:31549861-31549883 AATAATGTAGGCAGAAGGGATGG - Intronic
952493911 3:33899345-33899367 AAACATGTGAGAAGATGGCCGGG + Intergenic
953665937 3:44926615-44926637 ATTCATGAGAACGGATGGGACGG + Exonic
955002464 3:54939810-54939832 AATCATGTGGGCCGAAGGGCAGG - Intronic
955141956 3:56278321-56278343 AATCATGCGAAGATATGGGAAGG + Intronic
958492304 3:94792756-94792778 AATCATAGGAGGAGATGGAAAGG - Intergenic
958959524 3:100495658-100495680 AAGCAGTGGAGCAGATGGGAAGG - Intronic
960444228 3:117728128-117728150 CATCAGGTGAGCAGAGGGGCTGG + Intergenic
961116990 3:124338957-124338979 AATCATCTGGGCAGAGTGGAGGG + Intronic
962754056 3:138455029-138455051 GAACAGGTGAGCAGATGGGTGGG + Intronic
963286169 3:143436515-143436537 AATCATCTGACCAAATTGGAAGG - Intronic
967113565 3:186317345-186317367 AATCATGCGAGGAGATGGCAAGG - Intronic
967450079 3:189613669-189613691 ACTCATGAAAGCAGCTGGGAGGG + Intergenic
969996567 4:11318606-11318628 AATCACTTGAGAAGGTGGGAGGG - Intergenic
972848128 4:43014465-43014487 AATCAGGAGAGCAGATGGCAGGG - Intronic
973761262 4:54117742-54117764 AATCATTTGACCATATGAGAGGG + Intronic
975952384 4:79789285-79789307 AACCATGAAAGCAGCTGGGAGGG + Intergenic
976051812 4:81018768-81018790 AATCCTGTGAAAAGGTGGGAAGG - Intergenic
976227228 4:82805117-82805139 GATCAGGTGAGCAGATGGTTGGG + Intergenic
978339614 4:107708078-107708100 AATGAGATGAGTAGATGGGAAGG - Intronic
981317462 4:143353895-143353917 AATCTTGTGAGCAGATGGCAGGG - Intronic
982413544 4:155106227-155106249 AATCAGAAGATCAGATGGGAAGG + Intergenic
982661188 4:158209290-158209312 TGTCAGATGAGCAGATGGGAAGG - Intronic
985373737 4:189313204-189313226 AATCATGACAGAAGATGAGAGGG + Intergenic
986356528 5:6933722-6933744 ACTCACGTGGGCAGAAGGGATGG - Intergenic
987009098 5:13741994-13742016 AATCAAGGGAGAAGATGGAAGGG - Intronic
987491172 5:18581970-18581992 AAAAATGTGAGAAGATGGGCAGG + Intergenic
987764628 5:22209209-22209231 AATCCTGTGACAAGAAGGGAGGG - Intronic
989977721 5:50606932-50606954 AAGAATGTCAGCATATGGGATGG - Intergenic
990031971 5:51272390-51272412 GATCATGGGGGCAGCTGGGAGGG - Intergenic
991583730 5:68182264-68182286 AACCATGTGGGCAAGTGGGAAGG + Intergenic
991899366 5:71442359-71442381 AATCCTGTGACAAGAAGGGAGGG - Intergenic
992006731 5:72485800-72485822 AAGCAAGTGAGCAGGTGGTAGGG - Intronic
992030969 5:72721291-72721313 TAGGAGGTGAGCAGATGGGAGGG - Intergenic
993746659 5:91607462-91607484 AATAATATTTGCAGATGGGAGGG - Intergenic
994782460 5:104109458-104109480 AGTAATGTTAGCAGAAGGGAGGG - Intergenic
994782556 5:104110878-104110900 AGTAATGTTAGCAGAAGGGAGGG + Intergenic
995225329 5:109693947-109693969 AAGAATTTGAGCAGATGGAAAGG + Intronic
998679647 5:144452835-144452857 ACTGATGTGAGCACATGGGGAGG - Intronic
999622143 5:153484536-153484558 AATCATGGCAGCAGGTGGGCTGG + Intergenic
999700564 5:154224141-154224163 AAGCATTTGAGCAGCGGGGAGGG + Intronic
999732492 5:154485010-154485032 AAGCCTGTGAGCAGAAGGAAAGG - Intergenic
1001058911 5:168471620-168471642 AATCATGGGAGCCAAAGGGATGG - Intronic
1001193189 5:169649259-169649281 AAACATGTCAGCAGATGGCAGGG + Intronic
1001590321 5:172860349-172860371 AAGCATGTTAACAGATGTGAGGG - Intronic
1003091704 6:3109352-3109374 CATCATGTCAGCAGATCGGTGGG + Intronic
1003242310 6:4355324-4355346 ACTCATGTGGCCTGATGGGAGGG + Intergenic
1003318186 6:5030237-5030259 ACTCAGGGGAGCAGACGGGAGGG - Intergenic
1007173328 6:39879472-39879494 AATGAGGTGAGCATCTGGGAAGG + Exonic
1008873263 6:56298142-56298164 AAGCAAGTGAACAGATTGGAAGG + Intronic
1009247137 6:61252443-61252465 AAACATGTGGACACATGGGAGGG + Intergenic
1009825111 6:68857341-68857363 ACCCATGAGAGCAGCTGGGAGGG + Intronic
1010141160 6:72616238-72616260 AAACATTTGAGAAGATGTGACGG - Intergenic
1010426111 6:75730636-75730658 AATCATGTTCTCAGAAGGGAAGG + Intergenic
1010929119 6:81778713-81778735 AATAATGTGAATAGAGGGGAAGG - Intergenic
1011656569 6:89557278-89557300 GAGCATGTGAGCAGAAGGGAGGG + Intronic
1015885117 6:137909921-137909943 GAGCATCTGAGCAAATGGGAAGG - Intergenic
1017402528 6:154080663-154080685 AATCATGTGAGCAGATGGGATGG - Intronic
1024276106 7:47678422-47678444 AGGCATCTGGGCAGATGGGAGGG - Intergenic
1024635833 7:51289538-51289560 AAGCAGGAGAGCAGATGGGCAGG - Intronic
1025300687 7:57817936-57817958 GATCATGTGAGGAGATGCGTCGG + Intergenic
1026070754 7:67117305-67117327 AATCATGTGACAAAATGGGACGG - Intronic
1026706144 7:72694972-72694994 AATCATGTGACAAAATGGGACGG + Intronic
1027360486 7:77403499-77403521 AATTCTGGGAGCAAATGGGAGGG - Intronic
1027607551 7:80318775-80318797 ATTCAAGGGAGCTGATGGGATGG - Intergenic
1027872070 7:83720096-83720118 TATCATGTGAGCAGGTGAGGAGG - Intergenic
1028150421 7:87365525-87365547 AATGATGTGTGTTGATGGGATGG + Intronic
1028612140 7:92723699-92723721 AAACATGTTAGCAGCTGAGAAGG - Intronic
1031378638 7:121058499-121058521 AAACATGTAAGCACTTGGGATGG - Intronic
1032797718 7:135290924-135290946 AAGCATGCGAGCAAATGAGATGG - Intergenic
1034076317 7:148234904-148234926 AATCAAATGAACAGATGGTAAGG + Intronic
1034953986 7:155321969-155321991 AATTAGGAGGGCAGATGGGAAGG + Intergenic
1037402666 8:18508496-18508518 AATCATAGAAGCAGATGGCATGG - Intergenic
1038030947 8:23638653-23638675 GATCAAGTGAGCAAAGGGGAAGG - Intergenic
1038037041 8:23695193-23695215 AAGGATGTAAGCAGATGTGAGGG - Intergenic
1038091705 8:24261660-24261682 AGTCATGTTAACAGTTGGGAGGG - Intergenic
1039146698 8:34455191-34455213 AATCCTGTGAGGACATGGGAAGG - Intergenic
1039862241 8:41468918-41468940 GGTCATCTGAGCAGAAGGGAGGG - Intergenic
1040593912 8:48819733-48819755 AATCAGGCGAGCAGAGGGGCTGG - Intergenic
1041201532 8:55454782-55454804 AAACATCTGGGCAGATGGGCAGG + Intronic
1042099133 8:65255359-65255381 ATTTATGTAAGCAGATGGTAAGG - Intergenic
1042330692 8:67577333-67577355 GAGCATGTGAACACATGGGAAGG + Intronic
1043557144 8:81444549-81444571 AATCAAGTGCAGAGATGGGATGG - Exonic
1043825224 8:84920096-84920118 AATCAAGGTATCAGATGGGATGG - Intronic
1044628272 8:94255634-94255656 AATCAGGTGAGAAGAAGGGAAGG + Intronic
1046598076 8:116284804-116284826 AATCATGTGGGCAAATGGAAAGG + Intergenic
1047345659 8:124025905-124025927 ACTCATGTGAGAAGATGCCATGG - Intronic
1047842335 8:128766779-128766801 AATATTGTGGGCAGATGGGGAGG + Intergenic
1048516389 8:135115495-135115517 AGTCATGTGAGCACAGGGGAGGG + Intergenic
1049058887 8:140260356-140260378 AATCATGTGAACTGGTGAGAAGG + Intronic
1050823141 9:9908360-9908382 GAACATGTGAACAGGTGGGAAGG + Intronic
1051677921 9:19577234-19577256 AATTTTGTGAGCAACTGGGAAGG - Intronic
1051828893 9:21253558-21253580 AATCCTGTAAGCAGAGAGGAAGG + Intergenic
1052797204 9:32934011-32934033 AGGAATGTGAGCAGAAGGGAAGG - Intergenic
1056999263 9:91492607-91492629 AATCAAGTGAGAAGAGGAGATGG + Intergenic
1057088541 9:92234772-92234794 CATCATGGGAGCAGCTGGCATGG + Intronic
1057951479 9:99372359-99372381 AGTCATATGAGTAGGTGGGATGG + Intergenic
1058649483 9:107161470-107161492 AGTTGAGTGAGCAGATGGGAAGG + Intergenic
1058765115 9:108174877-108174899 AATCATAGGGGCAGATAGGAGGG - Intergenic
1059361189 9:113743119-113743141 AGTCATGTGGACACATGGGATGG - Intergenic
1187000657 X:15173456-15173478 AATCTTTTGGGCAGATGGTAGGG - Intergenic
1187456814 X:19448413-19448435 AATCAAGTGAGCAATTGGCAGGG + Intronic
1187578503 X:20583339-20583361 AATCAACTGAGCAGATAGTAGGG - Intergenic
1188626192 X:32288058-32288080 AATTATGAGAACAAATGGGATGG - Intronic
1189142381 X:38620297-38620319 CCTCATGGGAGCAGATGGGATGG + Intronic
1191696289 X:63994159-63994181 TATCTTGAGAGCAGATGGGGAGG - Intergenic
1191760456 X:64642642-64642664 AATGATGTCAGCAGTTGTGAAGG + Intergenic
1192208579 X:69112341-69112363 AGTCAAGTGAGGAGATGGAATGG + Intergenic
1192392072 X:70740312-70740334 TATCATGTGAGGACATGAGAAGG - Intronic
1193070255 X:77298913-77298935 GATCAGGTTACCAGATGGGAAGG + Intergenic
1193201178 X:78692864-78692886 AAGCATGTGAGCAGAAGAGCAGG + Intergenic
1193450818 X:81662939-81662961 ATACATGTGTGCATATGGGAAGG + Intergenic
1194484634 X:94472058-94472080 AATCATGGGGGCAGAGGGGCAGG + Intergenic
1195981187 X:110580188-110580210 ACCCATGTGAGTAGAAGGGAGGG - Intergenic
1198844834 X:140899789-140899811 AAACTTGAGAGCTGATGGGACGG - Intergenic
1201339739 Y:12921846-12921868 AATCACCTGAGCAGGAGGGAAGG - Intergenic