ID: 1017402529

View in Genome Browser
Species Human (GRCh38)
Location 6:154080667-154080689
Sequence TTCTAATCATGTGAGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017402529_1017402531 -8 Left 1017402529 6:154080667-154080689 CCCATCTGCTCACATGATTAGAA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1017402531 6:154080682-154080704 GATTAGAATCATCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 93
1017402529_1017402532 10 Left 1017402529 6:154080667-154080689 CCCATCTGCTCACATGATTAGAA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data
1017402529_1017402533 16 Left 1017402529 6:154080667-154080689 CCCATCTGCTCACATGATTAGAA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1017402533 6:154080706-154080728 GACCCGTACGTGAGTGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402529 Original CRISPR TTCTAATCATGTGAGCAGAT GGG (reversed) Intronic
904948639 1:34217907-34217929 TTCAAAGTATCTGAGCAGATGGG + Intronic
907207382 1:52785299-52785321 TTGTGATCATTTCAGCAGATAGG + Intronic
907348996 1:53810756-53810778 TACTAATCATGATGGCAGATGGG + Intronic
909451195 1:75799336-75799358 TTCAAATTATGTTAGCAGCTGGG + Intronic
911386380 1:97180316-97180338 CTTTATTCAAGTGAGCAGATGGG + Intronic
914786613 1:150838600-150838622 TTCTAATCATTTGATTAAATTGG + Intronic
921348848 1:214215062-214215084 TTCTTATCAATTGATCAGATGGG + Intergenic
921919664 1:220653128-220653150 TACTAATACTGTGAGCAGATGGG - Exonic
922598948 1:226835278-226835300 TTCTAATATCGGGAGCAGATTGG - Intergenic
1062789122 10:290240-290262 TTTGAATCATGTGAGCTGTTTGG - Intronic
1069085297 10:64131813-64131835 CTCTAATCATGTGAAAAGAAAGG + Intergenic
1069304334 10:66949832-66949854 TTCTAACAATGTGTGCAGAGAGG + Intronic
1071187207 10:83059160-83059182 TTTTAATGTTGGGAGCAGATTGG - Intergenic
1072870414 10:99113947-99113969 TACTAATAATGTCAGCACATAGG - Intronic
1076867167 10:133173539-133173561 TTTTAACAATGTGAACAGATTGG + Intronic
1079230486 11:18645041-18645063 TTCTAATATTGGGAGCAGATTGG - Intergenic
1080227328 11:29975420-29975442 TTTTAATGTTGGGAGCAGATTGG - Intergenic
1080531210 11:33178495-33178517 TTCTCAGAATGTGAGCTGATAGG + Intergenic
1083078433 11:60066038-60066060 TTCTCCTCATGTCAGCTGATGGG + Intronic
1083529436 11:63405790-63405812 TTGTTGTCATGTGAGCAAATTGG + Intronic
1086197971 11:84164811-84164833 TTCTAATTACGTGAGCTAATTGG + Intronic
1091305663 11:134534558-134534580 TTTTAATTTTGTGGGCAGATGGG - Intergenic
1097929189 12:65165866-65165888 TTCTAATAATGAGACCAGAAAGG + Intergenic
1104326357 12:127802423-127802445 TTTTAAAGCTGTGAGCAGATGGG + Intergenic
1105600501 13:21882237-21882259 TTGAAATCATGTGAGCAGGCTGG - Intergenic
1109023890 13:57135725-57135747 TTCTCGCCATGTGAGCAGAAAGG - Intergenic
1109827374 13:67739740-67739762 CTCTAATCCTGTGAGCTGGTTGG + Intergenic
1111183335 13:84696674-84696696 TTCCAATTATGTGATCAGTTTGG - Intergenic
1112006513 13:95258395-95258417 ATCTAATCATGGGAGAAGATGGG - Intronic
1112204637 13:97312295-97312317 TTTTAATCATGAGAGGATATTGG - Intronic
1112965624 13:105189331-105189353 TTCTAAACATGTGGGCTAATGGG - Intergenic
1113013513 13:105798964-105798986 ATATAATTATGTGAACAGATGGG - Intergenic
1113197127 13:107821274-107821296 TTGTAAACATTTGAGCACATTGG - Intronic
1113214715 13:108026211-108026233 TTCTACCCATGTCAGCAGACTGG + Intergenic
1114771076 14:25429381-25429403 TTCTAATGTCGGGAGCAGATCGG + Intergenic
1119772250 14:77227566-77227588 TTGAAGTCATGGGAGCAGATGGG + Intronic
1119912823 14:78366429-78366451 TTCTAATATTTTCAGCAGATGGG - Intronic
1120900480 14:89571116-89571138 TTCTAATCAGGTGTGCAGTCTGG + Intronic
1121646820 14:95524149-95524171 TTCTGAACATGTGATCATATTGG + Intergenic
1122106532 14:99461065-99461087 TTCTGAGCCTGTGGGCAGATAGG - Intronic
1128490996 15:68144267-68144289 TTCTAATTAGGATAGCAGATAGG - Intronic
1130167923 15:81482083-81482105 TACAAAGCATGTGGGCAGATGGG + Intergenic
1138953574 16:61943551-61943573 TGGTATTCATGTGAGCAGTTAGG - Intronic
1139319158 16:66099420-66099442 TGCTAATGCTGTGAGCAGATGGG + Intergenic
1140329224 16:74037148-74037170 TTCAGATCATGTGTGCAGAAAGG - Intergenic
1140598946 16:76451180-76451202 TTCTAATCATGTGCGATGAGGGG - Intronic
1148821925 17:50364843-50364865 TTCCAATCTGGTGAGGAGATGGG + Intergenic
1149054687 17:52349360-52349382 TTCTGATGATGTGACCTGATAGG - Intergenic
1149356911 17:55848479-55848501 TGGCAATCATGAGAGCAGATGGG + Intergenic
1149375009 17:56035017-56035039 TTCTACTCCTGTGATTAGATTGG + Intergenic
1149540840 17:57466991-57467013 TCCTTATCTTGTGAGCAGAAGGG + Intronic
1150645947 17:66977577-66977599 TTCTGATCATCTGATGAGATGGG - Intronic
1152755839 17:82086657-82086679 TTCTCATCCTGTGGGCAGAGCGG - Intronic
1156317240 18:35981509-35981531 TTCCAATCATGTGCTCAGAAAGG - Intergenic
1158244608 18:55417364-55417386 TCCTAATCTAGTGAGCAGATAGG - Intronic
1159035916 18:63276894-63276916 TTGTAATGATGTGGGTAGATAGG + Intronic
1159745096 18:72223420-72223442 GAATAATCATGTGAGCAGAACGG + Intergenic
1162262180 19:9542248-9542270 TTCTAGTCTTGGGAGCAGATTGG - Intergenic
925663026 2:6222687-6222709 TTCAACTCATGTGAGTATATTGG - Intergenic
928863354 2:35887245-35887267 TTCCAATCATGTGTGCAGTAGGG + Intergenic
931541289 2:63332170-63332192 TTCTAATCATATGATTAGAATGG + Intronic
931622613 2:64226473-64226495 TACTATTTATGTGAGTAGATTGG - Intergenic
938140156 2:128788174-128788196 TTCAAATCGTGTGAGCAGTGTGG - Intergenic
940512804 2:154640631-154640653 TTCTAATCATATGATTAGATCGG - Intergenic
940726469 2:157341804-157341826 TTCTAACGTTGGGAGCAGATTGG + Intergenic
941044165 2:160653531-160653553 TTCTACTCAGCTGAGGAGATAGG + Intergenic
941539340 2:166762665-166762687 TTGTAATTAGGTGAGCAGAATGG - Intergenic
941555185 2:166970030-166970052 TTCACATTATGTGGGCAGATTGG - Intronic
941589197 2:167397750-167397772 TTCTTGTCCTGTGAGTAGATCGG + Intergenic
946088230 2:217195940-217195962 TTCTAGTAAAGTGAGCAGCTTGG + Intergenic
948341868 2:237259445-237259467 TTGTAATCATGCAAGCAGAGTGG + Intergenic
948357256 2:237388622-237388644 TTCTAATCATTTGAGGAGGCAGG - Intronic
1168839236 20:898558-898580 TTCTAATGTTGGGAGCAGATTGG - Intronic
1169469548 20:5871935-5871957 TGCTAGTGCTGTGAGCAGATTGG - Intergenic
1171126511 20:22606613-22606635 TTGTAATCATGAGAGCTGCTGGG + Intergenic
1171273338 20:23833731-23833753 TTTGTATCATGTGAGCAGAGGGG - Intergenic
1172705124 20:36877546-36877568 TTCTAAGCTTGGGAGCAGAGGGG - Intronic
1174747899 20:53082261-53082283 TTATTAACATGTGAGCAGAATGG - Intronic
950453138 3:13076786-13076808 TTCTTATCATTTGTGCAGTTAGG - Intergenic
952148201 3:30556940-30556962 TTTTAATCATGTGAGGAAAATGG - Intergenic
953599469 3:44348693-44348715 TTCTAATGTCGGGAGCAGATTGG + Intronic
956498225 3:69851835-69851857 TTGTGAGCATGTGAGCATATTGG - Intronic
957880801 3:86210369-86210391 TTGTGATGATGTTAGCAGATGGG + Intergenic
958024754 3:88037729-88037751 TTCTATTCAGGGGAGAAGATTGG - Intergenic
958782091 3:98555021-98555043 TTTTAATCAAGTGAACAGGTAGG - Intronic
959110188 3:102113781-102113803 TTCTAATCAGGTGAGCTGCTCGG + Intronic
960601996 3:119468161-119468183 TTCTAATGAGCTGAGCAGAAGGG + Intronic
960859095 3:122133190-122133212 TTCTAAACTTGTCAGCACATAGG - Intergenic
961178831 3:124859719-124859741 TGCTAATCATGTAGGCAGTTAGG - Intronic
963349876 3:144139052-144139074 TTCTAATCTTGTGGACAGATAGG + Intergenic
966138214 3:176725356-176725378 GTCTAATGATGGGAACAGATGGG + Intergenic
967772656 3:193351926-193351948 TGCTAATAATGAGAGCAGAGAGG + Intronic
967911967 3:194549895-194549917 TTCTAATCATTTCAGGAGTTTGG + Intergenic
970356144 4:15254594-15254616 TTCTACTGCTGTTAGCAGATTGG + Intergenic
975614839 4:76235890-76235912 TTATCATCATTTTAGCAGATGGG + Intronic
981247002 4:142552481-142552503 CTCTAAGCATGTGCTCAGATAGG - Intronic
982338376 4:154266712-154266734 TTATAATCCTGTGATCATATGGG + Intronic
982488923 4:156003780-156003802 TTGTAATCATCTGAGAAAATAGG + Intergenic
987157255 5:15101741-15101763 TTCTAAACATTTAAACAGATTGG - Intergenic
994704778 5:103189242-103189264 TTCTAAACATGTCAGCAGGGTGG + Intronic
995595102 5:113739188-113739210 TTCAAGAAATGTGAGCAGATGGG + Intergenic
995631308 5:114135648-114135670 TTTTTCTGATGTGAGCAGATAGG + Intergenic
995769348 5:115652537-115652559 TTCTAATGTCGGGAGCAGATTGG - Intergenic
1000758171 5:165186466-165186488 TTCTTAGACTGTGAGCAGATGGG + Intergenic
1000847803 5:166303422-166303444 TTCTGATAAACTGAGCAGATTGG - Intergenic
1002385504 5:178862789-178862811 TTCTAGTCAGGAGAGCAGCTTGG - Intronic
1004883249 6:20028821-20028843 TTTTCATCTTGTGAGCACATAGG - Intergenic
1005326037 6:24701803-24701825 TTCTAATCATGTGTGATAATTGG + Exonic
1005776893 6:29143560-29143582 TTCTAATCATGGGCACATATTGG + Intergenic
1006806607 6:36793285-36793307 TCCAAATCAGGTGAGCAGAGCGG + Intronic
1011272754 6:85595777-85595799 TTCTAATCATAAGAGCAATTTGG - Intronic
1012106180 6:95161913-95161935 ATGTAATCATGTGAGTAGTTAGG - Intergenic
1012857414 6:104518706-104518728 ATCTGAGCATGAGAGCAGATAGG + Intergenic
1013808118 6:114016014-114016036 TTCTAATGTTGGGAGCGGATTGG + Intergenic
1014115378 6:117663385-117663407 TTCTAACGTTGGGAGCAGATTGG + Intergenic
1014317683 6:119887785-119887807 TTCTCAGCATCTGAGCAGATGGG + Intergenic
1014708959 6:124784002-124784024 TTCTAATCATGTTGGCATAAAGG + Intronic
1017163088 6:151383673-151383695 TTCTAAGCCTGTGTGCAGATGGG - Intronic
1017402529 6:154080667-154080689 TTCTAATCATGTGAGCAGATGGG - Intronic
1021043593 7:15893698-15893720 TTTGAATCATGTAACCAGATAGG - Intergenic
1024297081 7:47853078-47853100 TTTTAATCATGTAAACAGAAAGG + Intronic
1026070755 7:67117309-67117331 TTTTAATCATGTGACAAAATGGG - Intronic
1026706143 7:72694968-72694990 TTTTAATCATGTGACAAAATGGG + Intronic
1028362811 7:89989435-89989457 GTCTATTCATGCAAGCAGATAGG - Intergenic
1031797750 7:126198063-126198085 TAATAATCATGGGAGCAAATTGG - Intergenic
1032378684 7:131452109-131452131 TTCTAACCATTATAGCAGATTGG + Intronic
1035193805 7:157197798-157197820 TTCAAATCAGGTTAGCAGATGGG - Intronic
1036676225 8:10836091-10836113 TTTTAATTATGTGATGAGATGGG - Intronic
1037037505 8:14185956-14185978 TTCTAATCATATGATTAGTTTGG + Intronic
1038130985 8:24731320-24731342 TTCTCACGATGTGAGAAGATTGG - Intergenic
1041353029 8:56968087-56968109 TTTTAATCATGTTAGAATATTGG - Intronic
1041492204 8:58446011-58446033 TTCAAATCAGGTTAGCAGATGGG + Exonic
1043068249 8:75603794-75603816 TTCTTTTCATGAGAGTAGATGGG + Intergenic
1044224318 8:89702251-89702273 TTCTCTTCATGAGAGCAGTTTGG - Intergenic
1044628271 8:94255630-94255652 TGCTAATCAGGTGAGAAGAAGGG + Intronic
1046639454 8:116710816-116710838 TTGTAATTATTTTAGCAGATGGG - Intronic
1047545954 8:125816851-125816873 TACTAATCATGTAACCAGCTAGG - Intergenic
1050140446 9:2511443-2511465 TTCTAATGTTGGGAGCAGATTGG - Intergenic
1050975605 9:11934227-11934249 TTCTAAAGATGTGAGCACATGGG + Intergenic
1052660090 9:31418210-31418232 TTTTACTCATTTGAGAAGATTGG - Intergenic
1053401608 9:37829029-37829051 TCATAATAATGTGAGAAGATAGG + Intronic
1054827265 9:69585795-69585817 TGCTCAGCAGGTGAGCAGATGGG - Intronic
1059990375 9:119859727-119859749 TTCTGATCAAGTGAGCAAAAGGG - Intergenic
1185780857 X:2843515-2843537 TTCGAATCATGTGAAAATATAGG + Intronic
1186358933 X:8818575-8818597 TTCAAATCATTTGGACAGATGGG + Intergenic
1186398612 X:9235776-9235798 TTGAAATCATGTGAGAAGAAGGG + Intergenic
1186557859 X:10579540-10579562 TTCCCATTGTGTGAGCAGATTGG + Intronic
1186604148 X:11071313-11071335 TTCTCTTCATTTAAGCAGATAGG + Intergenic
1199462221 X:148097373-148097395 TTCTAACCTTATGAGCACATTGG + Intergenic
1199841913 X:151657894-151657916 TTCCAATCAAGACAGCAGATTGG - Intronic
1201289217 Y:12406613-12406635 TTCGAATCATGTGAAAATATAGG - Intergenic