ID: 1017402530

View in Genome Browser
Species Human (GRCh38)
Location 6:154080668-154080690
Sequence ATTCTAATCATGTGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017402530_1017402532 9 Left 1017402530 6:154080668-154080690 CCATCTGCTCACATGATTAGAAT 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data
1017402530_1017402531 -9 Left 1017402530 6:154080668-154080690 CCATCTGCTCACATGATTAGAAT 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1017402531 6:154080682-154080704 GATTAGAATCATCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 93
1017402530_1017402533 15 Left 1017402530 6:154080668-154080690 CCATCTGCTCACATGATTAGAAT 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1017402533 6:154080706-154080728 GACCCGTACGTGAGTGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402530 Original CRISPR ATTCTAATCATGTGAGCAGA TGG (reversed) Intronic
902065912 1:13687237-13687259 ATTTTAATCATGTCAGAAGAAGG + Intergenic
903296464 1:22346388-22346410 ATTCTTGCCATGGGAGCAGAAGG + Intergenic
903393705 1:22983243-22983265 ATTTGTCTCATGTGAGCAGAGGG + Intergenic
903394336 1:22987976-22987998 ATTTGTCTCATGTGAGCAGAGGG - Intergenic
903396406 1:23004883-23004905 ATTTGTCTCATGTGAGCAGAGGG - Intergenic
903908430 1:26703918-26703940 ACACTAATTATGTGAGCTGAAGG + Intronic
904948638 1:34217906-34217928 ATTCAAAGTATCTGAGCAGATGG + Intronic
905029300 1:34870755-34870777 AGTCTAATCATCAGGGCAGATGG - Intronic
905605732 1:39297573-39297595 GTTCTAATGTTTTGAGCAGAAGG + Intronic
909106536 1:71416892-71416914 ATTCTAACTTTGTGAGCAGGTGG - Intronic
909239290 1:73191778-73191800 ATTCTCATCAACTGAGCACATGG + Intergenic
909794170 1:79712394-79712416 AATCTAATTATGTGGGCTGAAGG + Intergenic
910001958 1:82352097-82352119 ATTTGTCTCATGTGAGCAGAGGG - Intergenic
913419588 1:118650305-118650327 ATTCTAATGCTCTTAGCAGATGG - Intergenic
913514810 1:119595768-119595790 TTTTTTATCATGTGAGCACAAGG - Intergenic
916539678 1:165740711-165740733 AATCTATTCATGAGGGCAGAGGG - Intronic
918175323 1:182039154-182039176 ATTAAAATCATGTGAACTGAAGG + Intergenic
918993743 1:191730779-191730801 ATTCTACTTATGAGAGCACAGGG + Intergenic
920832491 1:209478239-209478261 ATTCTCATCAGGAGAGCAGCCGG + Intergenic
921348847 1:214215061-214215083 ATTCTTATCAATTGATCAGATGG + Intergenic
921919665 1:220653129-220653151 GTACTAATACTGTGAGCAGATGG - Exonic
923805286 1:237250915-237250937 ATTCAGATTATGTTAGCAGAGGG + Intronic
1063190834 10:3693306-3693328 AGACTAATCTTGTGAGCAGCAGG - Intergenic
1064085215 10:12340615-12340637 AATCCCATCATGTGCGCAGAAGG - Intergenic
1064299139 10:14106581-14106603 ATTTTTATCATGTGAGAAAAAGG - Intronic
1065163178 10:22944777-22944799 ACACTAATCATGAGAGCAGAAGG - Intronic
1067538486 10:47134877-47134899 ATTCTTAACTTTTGAGCAGAGGG + Intergenic
1068230242 10:54161843-54161865 ATTTTAATCATTTGGGGAGATGG + Intronic
1070204757 10:74246411-74246433 GTTCTAATGAGTTGAGCAGATGG + Intronic
1071409691 10:85376979-85377001 ATTGTATTCATCTGAGCAGTGGG + Intergenic
1073420549 10:103420692-103420714 ATTTTAAAAATGGGAGCAGAGGG + Intronic
1073990116 10:109253020-109253042 ATTATAATGAGCTGAGCAGAAGG + Intergenic
1075242825 10:120793471-120793493 CTTCTAATCAGGGGAGCAGCAGG + Intergenic
1075920529 10:126208715-126208737 ATTTTAATCAGGTTACCAGATGG - Intronic
1078792572 11:14559316-14559338 TTTCTAATCATGAGAGAAAAGGG + Intronic
1080083569 11:28251705-28251727 ATTATAATCATGTGAGTAGATGG - Intronic
1081380067 11:42403901-42403923 AGTCTATTCATGTGGGCACAAGG + Intergenic
1081444174 11:43114130-43114152 ATTCAAATCATGTGGCCAGAGGG - Intergenic
1085762329 11:79252733-79252755 ATTCTTTTCATGGCAGCAGAAGG - Intronic
1086908731 11:92447807-92447829 AGGCTAATCTTGTGAGCAGTAGG + Intronic
1087384207 11:97448948-97448970 ATTCTAGTCAGTTGAGAAGATGG + Intergenic
1090921822 11:131213472-131213494 ATTTGTCTCATGTGAGCAGAGGG - Intergenic
1091305664 11:134534559-134534581 ATTTTAATTTTGTGGGCAGATGG - Intergenic
1093244545 12:16720410-16720432 ATCCTCAACATGTGAGCAGAAGG + Intergenic
1095321550 12:40834436-40834458 ATACTAGTCATGATAGCAGATGG + Intronic
1097514697 12:60590396-60590418 ATTCTAAATATGTGAGGTGATGG + Intergenic
1098042301 12:66364596-66364618 ATTTTTCTCAGGTGAGCAGAAGG - Intronic
1099170048 12:79352876-79352898 ATTCTAAAAATCTGAGCAGCAGG - Intronic
1100169652 12:91959673-91959695 ATTCTAATGATCTGGGTAGAGGG + Intergenic
1100795066 12:98173389-98173411 ATTCTTATCAGGTTAGCAAAGGG + Intergenic
1103540509 12:121663132-121663154 ATGGTAATAATGTGAGGAGATGG + Intronic
1104080016 12:125421683-125421705 ATTATAACCATTTGAGCAGAGGG + Intronic
1106986272 13:35355338-35355360 TTTCTAAGCATAGGAGCAGAGGG - Intronic
1107277625 13:38694128-38694150 ATTCTAATATTGTGAGCTGTTGG - Intronic
1112006514 13:95258396-95258418 GATCTAATCATGGGAGAAGATGG - Intronic
1113968662 13:114171116-114171138 ATTAAAATCATGTGAGCTAAAGG + Intergenic
1114731042 14:24993163-24993185 ATTCTGAACATGTGGGCTGAAGG - Intronic
1115495174 14:33997101-33997123 ATTATAATCATATGAATAGAGGG - Intronic
1115746077 14:36438934-36438956 ATTGTAAGCATGTCAGCACATGG + Intergenic
1116388536 14:44362389-44362411 ATTATAATCATGTGGGCAATGGG - Intergenic
1117134185 14:52717153-52717175 ATGCTAAGCATGTGAGGTGATGG + Intronic
1119343193 14:73898354-73898376 ATTCTATTGATGAGAGCAGAAGG + Intronic
1121630499 14:95418448-95418470 ATACTAATCATGACAGCAGCTGG - Intronic
1128923763 15:71635433-71635455 AAAGTAATCATGTGAGAAGATGG + Intronic
1130075752 15:80688409-80688431 AATCAAATAATGTGAGGAGAGGG - Intronic
1131122936 15:89834300-89834322 ATTCTCCTCATGAGAGCAGAAGG - Exonic
1131390213 15:92041901-92041923 ATTCTAATCATGTAATTGGAGGG + Intronic
1131406440 15:92168762-92168784 ATTTTAACCATGAGAGCAAAGGG - Intronic
1133253333 16:4499692-4499714 ATGATAAGCATGTGAGCTGATGG + Intronic
1138311967 16:56033295-56033317 ATCTTAATTATGTTAGCAGATGG - Intergenic
1139082753 16:63544403-63544425 ATTCTAAGCATGTGAGGATATGG + Intergenic
1139319157 16:66099419-66099441 CTGCTAATGCTGTGAGCAGATGG + Intergenic
1140598947 16:76451181-76451203 TTTCTAATCATGTGCGATGAGGG - Intronic
1141385059 16:83614448-83614470 AGGCTAAGCATCTGAGCAGAAGG - Intronic
1146503051 17:33380929-33380951 ATTCTAGGCAAGTGTGCAGAGGG - Intronic
1146537630 17:33666704-33666726 ATTCAACTCTTCTGAGCAGAAGG + Intronic
1148821924 17:50364842-50364864 ATTCCAATCTGGTGAGGAGATGG + Intergenic
1149356910 17:55848478-55848500 ATGGCAATCATGAGAGCAGATGG + Intergenic
1149540839 17:57466990-57467012 ATCCTTATCTTGTGAGCAGAAGG + Intronic
1153231053 18:2936537-2936559 ATTCTAATCACCTGAGCCCAGGG - Intronic
1157327919 18:46682144-46682166 ATGGTGATCATGTGGGCAGAGGG + Intronic
1157906717 18:51575693-51575715 ATACTAATCATGGTGGCAGAGGG + Intergenic
1158254218 18:55527292-55527314 ATCTAAATCAGGTGAGCAGAGGG + Intronic
1159821447 18:73150783-73150805 ATTATAGTCCTGTAAGCAGAGGG + Intergenic
1161868273 19:6850692-6850714 ATTAAAATCATGACAGCAGAAGG + Exonic
1164883341 19:31755438-31755460 ATGCTAAGCATTTGGGCAGAGGG + Intergenic
1167524525 19:49975347-49975369 ACCCAAATCAGGTGAGCAGACGG - Intergenic
1167952820 19:53041125-53041147 ATTTGTCTCATGTGAGCAGAGGG + Intergenic
1168255024 19:55160427-55160449 ATTCTAATCTTATCTGCAGAGGG - Intronic
928863353 2:35887244-35887266 TTTCCAATCATGTGTGCAGTAGG + Intergenic
930831022 2:55743187-55743209 ATGCTAACCATGTGAGAAAATGG + Intergenic
931040554 2:58293853-58293875 AGTCTAATCATGTAGACAGAGGG - Intergenic
931880588 2:66565995-66566017 ACTGGAATCATGTGAGCAGAAGG - Intronic
934888222 2:98043254-98043276 ATTTGACTCAGGTGAGCAGAGGG - Intergenic
935497760 2:103802777-103802799 AATCTAATCACATGAGCAGGAGG + Intergenic
935942803 2:108258946-108258968 ATTCTGATCATGGGAGAAAAAGG - Intronic
937180008 2:119986413-119986435 ATTTTAATCATGTGAGATGTTGG + Intergenic
937358779 2:121214533-121214555 ATTCTGATCATGTGTGCCCATGG - Intergenic
939516659 2:143177266-143177288 ACTCTAAGCATGTGAACAGCCGG - Intronic
940469170 2:154071698-154071720 ATTCCAGTCATGTGAGAAGAAGG + Intronic
941352809 2:164456889-164456911 ATTGTAATGATGAGAGCACAGGG - Intergenic
944081529 2:195793838-195793860 ATTCTAATCATGAAAGCAGTGGG + Intronic
944104605 2:196066182-196066204 ATTCTAGTCATTTGATCAGGAGG - Intronic
944979226 2:205095006-205095028 ATTCTAAATATTTGAGAAGATGG + Intronic
945626900 2:212220478-212220500 ATTCTGATGATTTTAGCAGAAGG + Intronic
947113127 2:226741485-226741507 ATTCCCTTCATGAGAGCAGAGGG + Intronic
1168827687 20:824862-824884 ATGCTAATGATGAGATCAGAGGG - Intergenic
1170524058 20:17219155-17219177 ATTTTAGTCATGTGACCTGAAGG - Intergenic
1171273339 20:23833732-23833754 ATTTGTATCATGTGAGCAGAGGG - Intergenic
1171285146 20:23930788-23930810 ATTTTAGTCATATGAGGAGATGG - Intergenic
1172705125 20:36877547-36877569 GTTCTAAGCTTGGGAGCAGAGGG - Intronic
1177312076 21:19411194-19411216 ATTCAAAACATGAGAGCAAAAGG - Intergenic
1178832575 21:36069117-36069139 ATTTTAATCAGTTGAGAAGATGG + Intronic
1180175400 21:46084680-46084702 ATTCTAATAATGTGAGAATAAGG + Intergenic
1182708287 22:32303486-32303508 ATTTGTCTCATGTGAGCAGAAGG + Intergenic
949091375 3:33525-33547 ATTCTTATAATGTGAGAAGCAGG + Intergenic
952500836 3:33960387-33960409 ATTCTAAACATTTTAGCACATGG + Intergenic
954932404 3:54295712-54295734 ATTTGCCTCATGTGAGCAGAGGG + Intronic
954951230 3:54475786-54475808 ATGGTAACCATGTGAGAAGATGG - Intronic
958525380 3:95252000-95252022 ATTTTTCTCAGGTGAGCAGAGGG + Intergenic
959029874 3:101286702-101286724 ATTCTGCTCATGTGAAGAGAAGG - Intronic
960070167 3:113420758-113420780 ATTATAATCATGTTATCAAATGG - Intronic
960601995 3:119468160-119468182 GTTCTAATGAGCTGAGCAGAAGG + Intronic
961177508 3:124848036-124848058 ATTCTATTAATGTGAGCAAATGG + Intronic
964076503 3:152699379-152699401 AGTCTAATGATGTGACTAGATGG - Intergenic
964913194 3:161807349-161807371 AATCCAATCAAGTGAACAGAAGG + Intergenic
966059901 3:175742129-175742151 ATTTGTCTCATGTGAGCAGAGGG + Intronic
966138213 3:176725355-176725377 AGTCTAATGATGGGAACAGATGG + Intergenic
970018253 4:11537077-11537099 ATTAAAATCATGTTAGCTGATGG - Intergenic
973233893 4:47875169-47875191 ATTCTAAGCATCTGAACACAAGG + Exonic
975614838 4:76235889-76235911 ATTATCATCATTTTAGCAGATGG + Intronic
976856971 4:89615587-89615609 ATTGTCTTCATGTGAGCAAAAGG + Intergenic
978711482 4:111788069-111788091 AGTTTAACCAGGTGAGCAGAGGG + Intergenic
982261181 4:153495629-153495651 ATTTTTTTCAGGTGAGCAGAGGG + Intronic
982559823 4:156916087-156916109 ATCCTAATTATATGAGCAGTGGG - Intronic
985120484 4:186636072-186636094 ACTCCAATCATGTGAGCAACGGG + Exonic
985621632 5:959180-959202 ATTCAAATAATGTAAGCATAAGG + Intergenic
986891187 5:12308867-12308889 ATTCTAACTATGTGAGATGATGG + Intergenic
988959425 5:36354871-36354893 CTTCTAATCTTGTTAGTAGAAGG - Intergenic
989285556 5:39695160-39695182 ATCTTTGTCATGTGAGCAGAAGG - Intergenic
989294298 5:39806129-39806151 ATTCAAAACATATGAGGAGAGGG + Intergenic
991086418 5:62651963-62651985 ATCATAAGCAGGTGAGCAGAGGG + Intergenic
993563249 5:89438845-89438867 ATTTTGACCATGTGACCAGAAGG - Intergenic
996311447 5:122110968-122110990 ATTCGAATGAGCTGAGCAGAGGG + Intergenic
996591957 5:125158218-125158240 GTTCTGATCATGTGACCAGCCGG - Intergenic
997803792 5:136892829-136892851 ATTCTAATCATGGGATTTGAGGG + Intergenic
1000292864 5:159887403-159887425 ATTATAATCATCTTATCAGATGG + Intergenic
1000717521 5:164664643-164664665 ATGCTAATGATGTGAGCTGATGG + Intergenic
1000758170 5:165186465-165186487 ATTCTTAGACTGTGAGCAGATGG + Intergenic
1000863676 5:166486757-166486779 ATTTTAAACATGGGAGGAGAAGG - Intergenic
1000963312 5:167626245-167626267 ATTCTCAAAATGTGATCAGAAGG + Intronic
1002933783 6:1654141-1654163 ATTCCAATCATCAGAGCACAAGG - Intronic
1004088513 6:12475104-12475126 CTTCTAATCAAGAGATCAGATGG + Intergenic
1006138403 6:31911494-31911516 ATTCTTTTAATGTGAGCAAAAGG + Intronic
1007152404 6:39707119-39707141 ATTCTACACATGTGAGAAAACGG - Intronic
1009272055 6:61625951-61625973 ATTTTGATTATGTGAGCAAATGG + Intergenic
1012009501 6:93764419-93764441 TTTCTAGTTATTTGAGCAGATGG + Intergenic
1014004247 6:116398635-116398657 ATCCTCTTTATGTGAGCAGAAGG - Intronic
1014317682 6:119887784-119887806 TTTCTCAGCATCTGAGCAGATGG + Intergenic
1014751097 6:125257110-125257132 TTTCAAATCATTTGAGGAGAGGG + Exonic
1017163089 6:151383674-151383696 GTTCTAAGCCTGTGTGCAGATGG - Intronic
1017402530 6:154080668-154080690 ATTCTAATCATGTGAGCAGATGG - Intronic
1018852507 6:167651177-167651199 AAGCTAATTATGTGAGCAGGTGG + Intergenic
1022522441 7:31016851-31016873 ATGCTCACCATGTGAGCTGAAGG - Intergenic
1023048286 7:36230154-36230176 ATTCTACACAGGTGAGCAGCTGG - Intronic
1024034891 7:45499225-45499247 ATTTTATTAATGTGAGCACAGGG - Intergenic
1026070756 7:67117310-67117332 ATTTTAATCATGTGACAAAATGG - Intronic
1026262198 7:68765001-68765023 ATGCACATCATGTGGGCAGAGGG + Intergenic
1026431933 7:70356450-70356472 AACCTAATCATTTGAGGAGAAGG + Intronic
1026706142 7:72694967-72694989 ATTTTAATCATGTGACAAAATGG + Intronic
1030694996 7:112575422-112575444 ATTTTAATCATCTGATCATATGG + Intergenic
1031127086 7:117787242-117787264 ACTCTAATGATGTTAGCAAAAGG + Intronic
1033919804 7:146376788-146376810 ATACTATTCATGAGGGCAGATGG - Intronic
1034572418 7:151967329-151967351 ACCATAATCATGTGAGCAGCTGG + Exonic
1035129342 7:156638436-156638458 AATTTAAACATGTGAACAGAGGG + Exonic
1035141218 7:156764106-156764128 ATTCTAATCAAGGGAATAGAAGG + Intronic
1035193806 7:157197799-157197821 ATTCAAATCAGGTTAGCAGATGG - Intronic
1035475730 7:159143202-159143224 AGTCTACTAATGTGAGAAGAAGG + Intronic
1036534060 8:9628112-9628134 ATTCAATACATATGAGCAGATGG - Intronic
1037156072 8:15700679-15700701 CTCCTAATCATCTGAGCAGTAGG + Intronic
1038197066 8:25378159-25378181 ATACTAATCATGTGACTAGAAGG - Intronic
1039449097 8:37657321-37657343 ATTCTAATCCTGCCAGCACAGGG - Intergenic
1040665382 8:49625200-49625222 ATTCTGATGAGCTGAGCAGAGGG - Intergenic
1041492203 8:58446010-58446032 ATTCAAATCAGGTTAGCAGATGG + Exonic
1044399183 8:91750594-91750616 ATACCAATCATGTGATTAGAGGG + Intergenic
1044628270 8:94255629-94255651 GTGCTAATCAGGTGAGAAGAAGG + Intronic
1045081231 8:98628147-98628169 ATTCTAATTCTGTCAGCAGTAGG - Intronic
1048552273 8:135444640-135444662 ATTTTAATGCTATGAGCAGAAGG + Intergenic
1050975604 9:11934226-11934248 TTTCTAAAGATGTGAGCACATGG + Intergenic
1051958137 9:22723858-22723880 ATTCTTATAATGTGAGCAGCAGG + Intergenic
1052095070 9:24373841-24373863 ATTTGTCTCATGTGAGCAGAGGG + Intergenic
1053578289 9:39375815-39375837 AATCTATTCATGAGAGAAGAGGG - Intergenic
1053842816 9:42203887-42203909 AATCTATTCATGAGAGAAGAGGG - Intergenic
1054586470 9:66972259-66972281 AATCTATTCATGAGAGAAGAGGG + Intergenic
1054827266 9:69585796-69585818 ATGCTCAGCAGGTGAGCAGATGG - Intronic
1059103187 9:111489260-111489282 ATTCTAATCATGGTTGGAGATGG - Intergenic
1059785952 9:117584413-117584435 ATTCTAAGCAGCTGAGTAGATGG - Intergenic
1059990376 9:119859728-119859750 ATTCTGATCAAGTGAGCAAAAGG - Intergenic
1060582744 9:124766509-124766531 ATTCTAGTCATGTGGGAAAAAGG - Intronic
1186398611 X:9235775-9235797 CTTGAAATCATGTGAGAAGAAGG + Intergenic
1188727589 X:33605839-33605861 ATGGTAACCATGTGAGGAGATGG + Intergenic
1190047355 X:47123407-47123429 TTTGTAATCTTGTCAGCAGAGGG - Intergenic
1193179646 X:78439747-78439769 ATTCATCTCAAGTGAGCAGAGGG - Intergenic
1194011445 X:88567285-88567307 ATGCTAATCTTGTGATCACAAGG + Intergenic
1194573381 X:95580577-95580599 ATTTTTCTCAGGTGAGCAGAGGG - Intergenic
1195730789 X:107964805-107964827 ATGGTAATCATGTGAGGTGATGG + Intergenic
1196938678 X:120754367-120754389 ATTAGAATCATCTGGGCAGAGGG - Intergenic
1197482892 X:127008894-127008916 ATTTTAATCAATTGAGAAGAAGG + Intergenic
1197553118 X:127919213-127919235 ATTCTAAACAATTGAGCAGGAGG - Intergenic
1198155039 X:133951162-133951184 ATACTAGTCATGTGAACAGAGGG - Intronic
1198798130 X:140421363-140421385 AATCTATTCATGAGGGCAGAGGG + Intergenic
1200062775 X:153491016-153491038 ATTCTGATGGTGTGAACAGAAGG - Intronic
1200285868 X:154821738-154821760 ATTTGTCTCATGTGAGCAGAGGG + Intergenic