ID: 1017402532

View in Genome Browser
Species Human (GRCh38)
Location 6:154080700-154080722
Sequence TCTGGTGACCCGTACGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017402530_1017402532 9 Left 1017402530 6:154080668-154080690 CCATCTGCTCACATGATTAGAAT 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data
1017402528_1017402532 14 Left 1017402528 6:154080663-154080685 CCATCCCATCTGCTCACATGATT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data
1017402529_1017402532 10 Left 1017402529 6:154080667-154080689 CCCATCTGCTCACATGATTAGAA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1017402532 6:154080700-154080722 TCTGGTGACCCGTACGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402532 Original CRISPR TCTGGTGACCCGTACGTGAG TGG Intronic
No off target data available for this crispr