ID: 1017402540

View in Genome Browser
Species Human (GRCh38)
Location 6:154080775-154080797
Sequence CTTTGGATGTATGGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402540 Original CRISPR CTTTGGATGTATGGTGTTGT GGG (reversed) Intronic
902331732 1:15734254-15734276 CCTTAGATGGATGGTGTTCTCGG - Exonic
902982074 1:20131405-20131427 CTATGGATGGATGGTGGTGATGG - Intergenic
903915252 1:26759166-26759188 CTTGAGATGTGTGGTGTTTTCGG + Intronic
905533598 1:38701405-38701427 GCTTGCATGTATGGTGTTTTGGG + Intergenic
905584937 1:39109074-39109096 CTTTGGATTTCTTCTGTTGTGGG + Intronic
905885852 1:41491490-41491512 CTTGGGATGCAGGGTGCTGTGGG + Intergenic
908694879 1:66827910-66827932 ATTTCGATGTTTTGTGTTGTAGG - Exonic
910575832 1:88762825-88762847 CTTTTTAGGGATGGTGTTGTGGG + Intronic
912895068 1:113577593-113577615 ATTGGGTTGTATGGTTTTGTGGG + Intronic
912998000 1:114551046-114551068 CTTTGGATGGATGGTGCTGATGG - Intergenic
913022119 1:114798493-114798515 GTGTGGATGTTTGGTGTTGAGGG - Intergenic
913179995 1:116311870-116311892 CTGTGGATGTGTGCTGTTCTGGG + Intergenic
913930227 1:124950948-124950970 CTTTGGATATTTGGAGCTGTTGG - Intergenic
916259384 1:162825629-162825651 CTGTGGATGGATGGTGGTGATGG + Intronic
917053322 1:170949851-170949873 CTTTGTATCTCTGGGGTTGTAGG - Intronic
919694466 1:200560258-200560280 TTTTGGTTGTTTGGTTTTGTTGG + Intronic
920026959 1:203006124-203006146 TTTTGGAGGTATGGTGTGTTAGG + Intergenic
922968430 1:229713575-229713597 CTTTGGAACTATGGTGTTACAGG + Intergenic
1063119463 10:3094564-3094586 CTTGGGATGTGTGTTGGTGTGGG + Intronic
1065457414 10:25921657-25921679 CTGTGGATGTATGGCGGTGATGG + Intergenic
1067257325 10:44654695-44654717 TTTTGGATTTTTGTTGTTGTTGG + Intergenic
1069848120 10:71386795-71386817 ATTTGCAGGAATGGTGTTGTAGG + Intergenic
1071944253 10:90623748-90623770 CTTAGTAAGTATGGTGTGGTAGG - Intergenic
1072211521 10:93250849-93250871 CTGTGGATGGATGGTGGTGAAGG - Intergenic
1074132214 10:110590322-110590344 TTTAAAATGTATGGTGTTGTGGG + Intronic
1074377731 10:112952551-112952573 CTTGGGATGTATGGCGGGGTCGG + Intronic
1075056079 10:119219451-119219473 CTTTGGATTTCTGATGTTTTTGG - Intronic
1076347038 10:129786176-129786198 CTAAGGATGTATGGAGCTGTCGG + Intergenic
1076592292 10:131592108-131592130 CTGTGGATGGATGGTGGTGATGG - Intergenic
1077811643 11:5643829-5643851 CTTGAGATGTATGGTGTATTTGG + Exonic
1077963328 11:7098867-7098889 CTATGGATGGATGGTGGTGATGG - Intergenic
1078626090 11:12959918-12959940 CTGTGGATGGATGGTGGTGATGG - Intergenic
1079879790 11:25912024-25912046 CTTTAAATGTTTGGTGTTGTAGG - Intergenic
1079960747 11:26920236-26920258 CTTTTGATGGAGGGTGTGGTGGG - Intergenic
1080690310 11:34551636-34551658 CTTTGGATTTATCTTGTTTTGGG + Intergenic
1081311967 11:41585374-41585396 GATTGGATGGCTGGTGTTGTGGG + Intergenic
1081379112 11:42393345-42393367 CTCTGGATGGAAGCTGTTGTGGG + Intergenic
1081418821 11:42847532-42847554 TTTTGGATGTCTGATTTTGTTGG - Intergenic
1082997032 11:59262916-59262938 CTCTGTATGTGTGGTGCTGTGGG - Intergenic
1083278386 11:61610580-61610602 CTTTGGGTGTGTGATCTTGTCGG + Intergenic
1085967347 11:81543849-81543871 ATTTGGAAGAATGGTGTTATGGG + Intergenic
1086821237 11:91438602-91438624 CTTTGCATGTAGGGTGTTAGTGG - Intergenic
1089657077 11:119956426-119956448 TTTTGGCTGTATGGGGTTGTTGG - Intergenic
1095091227 12:38108223-38108245 CTTTGGTTGTTTTGTGTTGTGGG - Intergenic
1097829900 12:64213173-64213195 CTATGTATGTATGTGGTTGTAGG + Intronic
1098104065 12:67051087-67051109 CTTAGGGTATATGGTGTTGTGGG + Intergenic
1103255917 12:119541278-119541300 CTTTGGATGGATGGTTGGGTGGG + Intergenic
1103268996 12:119656678-119656700 CTGTGGATGGATGGTGATGATGG + Intergenic
1103361975 12:120359872-120359894 CTTTGGATGTCTGGTCATTTGGG - Intronic
1110069656 13:71158267-71158289 CTGTGGATGGATGGTGGTGTTGG + Intergenic
1111242882 13:85498639-85498661 CTTTTGATATATGGTGTCGTTGG + Intergenic
1111919059 13:94391723-94391745 CTGTGGATGGATGGTGATGATGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114201905 14:20529069-20529091 TTTAGGCTGTATGGTGTTATTGG - Intergenic
1116590850 14:46770643-46770665 CTTGGGATGTCAGGTGTTATGGG + Intergenic
1117661121 14:58005970-58005992 TTTTGGAGGTATCGTGTTGTTGG - Intronic
1121906880 14:97754041-97754063 CTGTGGATGGATGGTGGTGATGG - Intronic
1127549647 15:60024206-60024228 CCTTGGATGTATGGGATTTTGGG + Intronic
1127998226 15:64167611-64167633 TGTTGGCTGTATGGTGTTGCAGG + Exonic
1128630736 15:69263993-69264015 CTTTCTTTGTATGGTGTTGGTGG + Intronic
1129088310 15:73120963-73120985 CTTTGGATGTATGCATTTTTGGG - Intronic
1131805997 15:96123331-96123353 CTTTTGATGTAAAATGTTGTGGG - Intergenic
1132988346 16:2779665-2779687 TTTTGGAAGTGTGGTCTTGTGGG + Intergenic
1134410793 16:14001721-14001743 CTTTGGATGAGAGTTGTTGTCGG - Intergenic
1137773564 16:51037628-51037650 CTTTGGATGGATGATGGTGATGG - Intergenic
1138080224 16:54083715-54083737 CTTTGGAAGGATGCTGGTGTTGG - Intronic
1140292981 16:73681062-73681084 CAGTGGATGTCTGGTCTTGTGGG + Intergenic
1142584457 17:962609-962631 CTTTGGATTTAAGGTGAGGTGGG + Intronic
1143672014 17:8403407-8403429 CTCTGGATGGATGGTGGTGATGG + Intergenic
1144450729 17:15376084-15376106 CTCTGGATGGATGGTGGTGATGG + Intergenic
1146247769 17:31305280-31305302 TGTTGGTTGTTTGGTGTTGTAGG + Exonic
1146476992 17:33170975-33170997 CTTCAGATGTGTGATGTTGTGGG + Intronic
1148655529 17:49280405-49280427 CTTTGAATTTATGTTGTAGTAGG - Intergenic
1149606351 17:57927666-57927688 CTTTGGATGAGTGGGGTTGGGGG - Intronic
1150164920 17:62932431-62932453 CTTAGGATGGATGGTGTTATGGG + Intergenic
1151465503 17:74282285-74282307 TTTTGGATGTTTGGTGTAGCTGG + Intronic
1152490499 17:80629535-80629557 CTCTCTATGTATTGTGTTGTTGG + Intronic
1152490509 17:80629675-80629697 CTCTCTATGTATTGTGTTGTTGG + Intronic
1152490514 17:80629745-80629767 CTGTCTATGTATTGTGTTGTTGG + Intronic
1153174373 18:2354398-2354420 CTGTGGATGAATGGTGATGATGG - Intergenic
1153641812 18:7164072-7164094 CTTTGGATGTGTTGAGTTTTAGG + Intergenic
1154078056 18:11224535-11224557 CTTTGAGTGCATGGTGATGTAGG + Intergenic
1155836163 18:30587524-30587546 CTGTGGATGGATGGTGGTGGTGG - Intergenic
1157105086 18:44766606-44766628 CTGTGGATGGATGGTGGTGATGG + Intronic
1159958295 18:74535232-74535254 CTTTGGCTGTGAGGTTTTGTGGG + Intronic
1160236722 18:77091689-77091711 GTTTGCATGTATGGTGATGTGGG - Intronic
1166094774 19:40531714-40531736 TTTTGGATGACTGGTTTTGTTGG + Intronic
925123954 2:1440491-1440513 TTTTGTTTGTATGGTGTAGTCGG + Intronic
926363554 2:12112742-12112764 GTTATGATGTATGGTGTTGGAGG + Intergenic
927057225 2:19376529-19376551 CTTTGGGTGAATGGTATGGTCGG - Intergenic
927286117 2:21358754-21358776 ATTTGGATGTATGCGATTGTGGG + Intergenic
928112072 2:28518749-28518771 CTGTGGGTGGATGGTGTTGTGGG + Intronic
930335487 2:50039671-50039693 CTTTGGAGGTAGGTTGTTGAGGG + Intronic
931689753 2:64825277-64825299 CTGTGGATGGATGGTGGTGATGG + Intergenic
934719691 2:96564907-96564929 CTTTTTATGTATTTTGTTGTTGG + Intergenic
936276803 2:111105994-111106016 CTTTGGATTTATGCTGTTTGGGG + Intronic
936558561 2:113516898-113516920 CTATGGATGGATGGTGGTGATGG - Intergenic
937147085 2:119656765-119656787 TTTTGGAGGTGTGGTGTGGTGGG + Intronic
939737676 2:145868945-145868967 GTATGGATGAATGGTTTTGTGGG + Intergenic
943892695 2:193310571-193310593 ATATGTATGTATGGTGTTTTTGG - Intergenic
944361471 2:198862407-198862429 CTTTGGAGGCATGTTGTGGTTGG + Intergenic
945798952 2:214400590-214400612 CTCTGTATCTATGGGGTTGTTGG - Intronic
946528667 2:220547795-220547817 CTTTGGAGGTGTGGGGATGTGGG - Intergenic
947970307 2:234317861-234317883 GTTTGGATGTACAGCGTTGTAGG + Intergenic
1169137184 20:3204272-3204294 CTTTGGAGGTATGGAGTTCCCGG + Intronic
1169995094 20:11547231-11547253 CTCTGTATGAATGCTGTTGTGGG + Intergenic
1171747846 20:29016403-29016425 CTTTGGTTGTTTTGTGTTGTGGG + Intergenic
1172686081 20:36755681-36755703 CTTTGACTGTATGGAGTTGGTGG - Exonic
1173717493 20:45221791-45221813 CTTTGGATTTAGTATGTTGTTGG - Exonic
1174395979 20:50247158-50247180 CTTTGGAGGTGTGGAGTTGGGGG + Intergenic
1176317687 21:5263335-5263357 CTTTTGTTGTTTTGTGTTGTGGG - Intergenic
1176475552 21:7200110-7200132 CTTTTGTTGTTTTGTGTTGTGGG - Intergenic
1179181125 21:39046191-39046213 CTGTGGATGGATGGTGGTGATGG - Intergenic
1179353363 21:40634461-40634483 CTTTGGAGGAAGAGTGTTGTAGG - Intronic
1179653203 21:42828450-42828472 CTTTGGTTGTCTGTTCTTGTAGG + Intergenic
1180395365 22:12327694-12327716 CTTTTGTTGTTTTGTGTTGTGGG - Intergenic
1180404380 22:12537057-12537079 CTTTTGTTGTTTTGTGTTGTGGG + Intergenic
950106086 3:10389665-10389687 CTGTGGATGGATGGTGGTGATGG + Intronic
950310510 3:11953825-11953847 CTCTGGATGTCTGGTGTCTTTGG - Intergenic
951343095 3:21512640-21512662 CTTTTGATGTTATGTGTTGTTGG - Intronic
951988640 3:28650248-28650270 CTGTGGCTGTATGGTATTATGGG + Intergenic
953408690 3:42675122-42675144 CTGTGGATGGATGGTGGTGATGG - Intergenic
954851911 3:53608945-53608967 CTTTAAATGTCTGGTATTGTTGG + Intronic
956953151 3:74305694-74305716 CTTTGGAGGTATGGTAGTTTTGG + Intronic
957907281 3:86573850-86573872 CTTTGGTTGCCTGGTTTTGTGGG - Intergenic
959394573 3:105821165-105821187 GTTTGGATGTATTTTGTTTTTGG - Intronic
961157943 3:124696769-124696791 CTGTGGATGGATGGTGGTGATGG - Intronic
961525120 3:127491861-127491883 CTGTGGATGGATGGTGGTGATGG + Intergenic
963282448 3:143398045-143398067 TTTTGAATGAATTGTGTTGTAGG - Intronic
967266363 3:187695690-187695712 CTGTGGATGCATGGTGTTTCTGG - Intergenic
967570222 3:191019579-191019601 CTTCGGATATATGGGGTTGGGGG + Intergenic
967647632 3:191945457-191945479 CTTAGAATGTATGTTTTTGTGGG - Intergenic
970342792 4:15124303-15124325 CTCAGGTTGTATGATGTTGTGGG - Intergenic
971385698 4:26138993-26139015 CTTTGGATGTCCGGGATTGTTGG - Intergenic
972143941 4:35998002-35998024 CCTTGGATGTGTGGTGCTTTGGG + Intronic
972698019 4:41466849-41466871 CTGTGGATGGATGGTGGTGATGG - Intronic
974511045 4:62841251-62841273 CTTTGGATGTGTGCTGTTCTGGG + Intergenic
976151127 4:82093099-82093121 CTTTGGATGCTTTGTGTTCTTGG - Intergenic
977998272 4:103522973-103522995 CTGTGGATGTGTGATGTTGATGG - Intergenic
978029147 4:103916874-103916896 CTTTACATATATGGTATTGTAGG - Intergenic
978637839 4:110831591-110831613 CTTAGTATGTTTGGTGTAGTAGG + Intergenic
983250991 4:165346289-165346311 CTTTGGATGTATTTTTCTGTGGG - Intergenic
983949967 4:173627938-173627960 CTTTGGAGATATGGAGGTGTAGG + Intergenic
984426164 4:179588877-179588899 CTGTAGATGGATGGTATTGTTGG + Intergenic
990923285 5:60992328-60992350 CTTTGGATGTCTGTGCTTGTGGG + Intronic
991067803 5:62442248-62442270 CTTTGAATCTATGCTGTAGTGGG + Intronic
993489915 5:88534439-88534461 CTGTGGATGGATGGTGGTGATGG + Intergenic
994171778 5:96665606-96665628 GTTTGTATGTATTTTGTTGTGGG - Intronic
994321058 5:98395047-98395069 ATTTGGATTTATGGTGTTCGTGG - Intergenic
994869598 5:105330129-105330151 CTTTGGATATTTGCTGTTATAGG + Intergenic
998367190 5:141639102-141639124 CCTTGCATGTATGGGGTTGGGGG + Intronic
1002537429 5:179884917-179884939 CTGTGGATGGATGGTGGTGATGG + Intronic
1004804054 6:19182584-19182606 TTCTGGATGTATGGAGTTGAAGG + Intergenic
1007348116 6:41248407-41248429 CTTTTTATGTGTGGTTTTGTGGG + Intergenic
1008302075 6:49853559-49853581 TTTGGGAGGTATGGTGTTTTGGG - Intronic
1008364342 6:50659003-50659025 CTTTGGATGAATGGTGGTGATGG + Intergenic
1013503722 6:110778044-110778066 CTGTGGATGGATGGTGGTGATGG + Intronic
1015762519 6:136680246-136680268 CTGTGGATGGATGGTGATGATGG + Intronic
1015793073 6:136983283-136983305 CTTTAGATGTATGGAATTCTGGG + Intergenic
1017402540 6:154080775-154080797 CTTTGGATGTATGGTGTTGTGGG - Intronic
1018969851 6:168519583-168519605 CTTTGGATGTGCGATGTTCTAGG - Intronic
1019053288 6:169201042-169201064 TTTGGGATGGATGGTGTTGTTGG - Intergenic
1020014453 7:4822731-4822753 CTCTGGCTGTCGGGTGTTGTAGG - Intronic
1020680392 7:11229832-11229854 CTATGGATGGATGGTGGTGATGG - Intergenic
1020856124 7:13426506-13426528 CTTTGGCTATTTGGGGTTGTTGG - Intergenic
1022895344 7:34745093-34745115 CTTTGTATATATGGGGTTATTGG - Intronic
1024566241 7:50683370-50683392 CTATGGATGGATGGTGGTGAAGG + Intronic
1025641906 7:63381879-63381901 CTTAGGATATATGATGTTTTAGG - Intergenic
1025868567 7:65408496-65408518 CTTTGGTTGTTTTGTGTTGTGGG + Intergenic
1027605800 7:80297087-80297109 CTTTGGTTTGATGGAGTTGTTGG + Intergenic
1028020181 7:85761339-85761361 ATTTGGATGGATGGTATTTTTGG - Intergenic
1028528528 7:91812416-91812438 CTTTGGGGGTATTGGGTTGTAGG - Intronic
1030443275 7:109615903-109615925 TTTTGGATGCATTGTGTAGTGGG + Intergenic
1030873698 7:114787896-114787918 CTAGGGATGTATGGTCTTATTGG + Intergenic
1032864994 7:135916283-135916305 CTTTGGATGTAGAAGGTTGTTGG + Intergenic
1033005773 7:137560459-137560481 CTTTGCATTTATGCTGTTTTAGG - Intronic
1034871552 7:154689324-154689346 CTTTGGTTGGTTGTTGTTGTTGG + Intronic
1035687441 8:1535885-1535907 CTGTGGATGGATGGTGTTGGTGG + Intronic
1036617491 8:10399875-10399897 CTTTAGATGGATGGTCTTGGGGG + Intronic
1038258825 8:25975089-25975111 ACTTGGGTGTATGGTGTTTTAGG - Intronic
1040349319 8:46547839-46547861 CATTGGAGGTACGGTGTTGTGGG + Intergenic
1040938807 8:52811418-52811440 CTTTGGATTTATTCTGTTGGAGG + Intergenic
1043226857 8:77744509-77744531 CTTTGGATATATTGAGTTGGAGG + Intergenic
1043477444 8:80619161-80619183 CTTTGTATTTGTGGTGCTGTGGG - Intergenic
1045629725 8:104104413-104104435 GTTTTGATGGATGGGGTTGTTGG + Intronic
1046233126 8:111384085-111384107 CCTGGGATTTTTGGTGTTGTTGG + Intergenic
1048767922 8:137864313-137864335 TTTTGGATGTATGGTATGTTTGG - Intergenic
1049894284 9:99257-99279 CTATGGATGGATGGTGGTGATGG + Intergenic
1050186277 9:2977828-2977850 CTGTGGATGGATGGTGGTGATGG + Intergenic
1052387030 9:27835025-27835047 CTTTGGATGAATTTTTTTGTGGG + Intergenic
1053170698 9:35879447-35879469 TTTTGGATCTATGATTTTGTAGG + Intergenic
1053735514 9:41099361-41099383 CTATGGATGGATGGTGGTGATGG + Intergenic
1054692863 9:68332039-68332061 CTATGGATGGATGGTGGTGATGG - Intronic
1055863271 9:80781227-80781249 ATTTGGATGTATAGATTTGTTGG + Intergenic
1056772059 9:89484790-89484812 GTGTGGATGTATTGTGTGGTGGG + Intronic
1057166056 9:92926286-92926308 CCTTGGATGTAGGCAGTTGTGGG + Intergenic
1061510948 9:131060713-131060735 CTTTGAATGCATGGTCTTGTTGG + Intronic
1061573759 9:131493615-131493637 CTTTGTTTCTATGGTGTTTTAGG + Intronic
1061778259 9:132980601-132980623 CTGTGGATGGATGGTGGTGATGG - Intronic
1062455528 9:136635673-136635695 GTTTGGATAGATGGTCTTGTCGG - Intergenic
1203410986 Un_KI270579v1:2799-2821 CTTTTGTTGTTTTGTGTTGTGGG - Intergenic
1186026976 X:5323960-5323982 GCTTGGTTGTCTGGTGTTGTTGG - Intergenic
1188005861 X:25015474-25015496 ATTTGGATGTTTGGTGTTCGGGG - Intronic
1189642851 X:43092639-43092661 CTTTGGATTTATTCTATTGTAGG + Intergenic
1189707441 X:43773056-43773078 CTTTGCATGGATGGTGTATTAGG - Intronic
1189808850 X:44762578-44762600 CTTTTGGTCTATAGTGTTGTGGG + Intergenic
1194226268 X:91262806-91262828 GTTTGTGTGTTTGGTGTTGTTGG + Intergenic
1199354437 X:146845041-146845063 CTTTGGCTGTATGGGTTTTTTGG - Intergenic
1199420696 X:147641088-147641110 TTTTGGATGTATGTAGTAGTTGG - Intergenic
1199964465 X:152808064-152808086 CTGTGGATGGATGGTGGTGATGG - Intergenic