ID: 1017402568

View in Genome Browser
Species Human (GRCh38)
Location 6:154081101-154081123
Sequence AGCACAGATGTCCAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017402567_1017402568 -8 Left 1017402567 6:154081086-154081108 CCAACACGGCAAGCAAGCACAGA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG 0: 1
1: 0
2: 2
3: 31
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017402568 Original CRISPR AGCACAGATGTCCAAACAAA AGG Intronic
902534511 1:17111817-17111839 AGCAGAGATTTCCAAGCAACAGG + Intronic
902851542 1:19161763-19161785 AGCTCAGAAGTCCCAACAATCGG + Intronic
903408016 1:23115264-23115286 ATGACAGATGAGCAAACAAAGGG + Intronic
905585694 1:39115910-39115932 ACTACAGATGTCCAAAATAAAGG + Intronic
906750991 1:48259720-48259742 GGCAGAGATGTGCAAAGAAATGG - Intergenic
907406313 1:54255596-54255618 ATCACAGATGAGGAAACAAAAGG - Intronic
907415243 1:54309953-54309975 AGCACAAATCTCAAAACAAAAGG + Intronic
907599790 1:55756647-55756669 ATCACAGAGGTGCAGACAAAGGG - Intergenic
908874630 1:68657784-68657806 AGCAAAGATTTCCAGACAAATGG + Intergenic
909148762 1:71972862-71972884 ATCTCAGATTTCCAACCAAAGGG - Intronic
909175418 1:72351485-72351507 AGCACAGATGTCTTAATAATTGG - Intergenic
910189620 1:84582220-84582242 AGCTCAGAGGTCCAAACTCATGG + Intergenic
910755709 1:90688436-90688458 AGCACACCTGTCCAGACAGAGGG + Intergenic
911409722 1:97487942-97487964 ACAACTTATGTCCAAACAAAAGG + Intronic
912022778 1:105126933-105126955 AGCAGATATGTCTAAACAGATGG + Intergenic
912040066 1:105378862-105378884 ATCATAGATGAACAAACAAATGG - Intergenic
915010764 1:152684172-152684194 AGCATGTATGTCCAAACATAGGG - Intergenic
916960842 1:169887299-169887321 AGCACAGAAGTCCTCAAAAATGG + Intronic
917931015 1:179822889-179822911 AGCACAGGGGCCCAACCAAAGGG + Intergenic
919516771 1:198534455-198534477 AGGCCAGAAGTCCAAACAGAAGG - Intronic
921407211 1:214793453-214793475 TCCACAGATTTCCATACAAATGG - Intergenic
921660814 1:217800096-217800118 AGGACAGAAATCCAAACATAAGG - Intronic
921680976 1:218030617-218030639 AGCACAGACATGCAAACTAAGGG - Intergenic
923844742 1:237717298-237717320 GGCACAGATGTTCAACCCAATGG - Exonic
1064382559 10:14859294-14859316 AGCACAGAAGTGAAAACACAAGG - Intronic
1064687071 10:17873990-17874012 AGCTCATATGCCCAAACATAAGG + Intronic
1065241624 10:23711066-23711088 AGCTCAGATGTGCATACAGAAGG + Intronic
1066027345 10:31373952-31373974 GACACAGATGCCCAAAAAAAGGG - Intronic
1066333540 10:34451632-34451654 GGGACATATGTTCAAACAAAAGG + Intronic
1067074956 10:43172858-43172880 AGCAGAGCTGTCCAAAGAACAGG + Intronic
1067105262 10:43362196-43362218 AGCACATATGGGTAAACAAATGG + Intergenic
1068262897 10:54606235-54606257 AGAAAAAATGCCCAAACAAATGG - Intronic
1069943226 10:71969468-71969490 AGTACAGATGTCCATAGAACGGG + Intronic
1069964791 10:72105428-72105450 AGCACAGAGAGCCAAATAAATGG + Intronic
1072027177 10:91471804-91471826 ATTACAGATGAACAAACAAATGG + Intronic
1072992694 10:100212678-100212700 AACACAGATGCCCAAATAAGTGG + Intronic
1076222001 10:128741346-128741368 AGCACATATGTGCACACACACGG + Intergenic
1079448775 11:20581260-20581282 GGCACAGATGTCCTCACAAATGG + Intergenic
1080797606 11:35579859-35579881 AGCAGAGATGACCCAACAAAAGG + Intergenic
1081439180 11:43061665-43061687 AGGACAGATGTATAAATAAAGGG + Intergenic
1081828212 11:46079810-46079832 AAAACAGAAGCCCAAACAAATGG + Intronic
1081848197 11:46256045-46256067 AATACAGATGAACAAACAAAAGG + Intergenic
1087427577 11:98010692-98010714 AACACAGATGTCACAACAAAAGG - Intergenic
1087827094 11:102777769-102777791 AGAACAGTTGTTCAAATAAAAGG + Intronic
1088875325 11:113930925-113930947 AGCAGAGAAATCCAAACATACGG + Intronic
1089801192 11:121029341-121029363 AGCTGAGACGTCCAGACAAATGG - Intronic
1094207819 12:27859349-27859371 AGCAGAGAAGTACAGACAAAAGG + Intergenic
1094307309 12:29035242-29035264 ACCATAGATCTCAAAACAAAAGG + Intergenic
1096428888 12:51527051-51527073 AGCACAGATGTCCAACAATAGGG - Intergenic
1096790140 12:54039362-54039384 GGCACAGAGGCCCAAATAAATGG + Intronic
1098622497 12:72620031-72620053 AGAACAGACATGCAAACAAATGG + Intronic
1098741863 12:74182693-74182715 ATCACAGATGACCATATAAAAGG + Intergenic
1101445269 12:104732820-104732842 AGACCAGATGGCAAAACAAATGG + Intronic
1101509247 12:105377936-105377958 AGCACAGATTCCCATAGAAATGG + Intronic
1103736126 12:123061935-123061957 GGCACAGGTGTTCTAACAAAGGG + Intronic
1104116575 12:125754790-125754812 AGGACAGATGTCCAAAGGAGAGG - Intergenic
1106147501 13:27063247-27063269 AGCTCAGATATACAGACAAATGG + Intergenic
1106742191 13:32656483-32656505 ACCACAGATGACACAACAAATGG - Intronic
1108224580 13:48275120-48275142 ATCACAGATCTACAAACACAGGG + Intergenic
1109358305 13:61262561-61262583 AGCAAATATGTCCAGACAAAAGG + Intergenic
1109972870 13:69792571-69792593 AAAACATATGTTCAAACAAAAGG + Intronic
1110861076 13:80345072-80345094 GTCACAGTTGTCAAAACAAAAGG - Intergenic
1111227269 13:85290058-85290080 AGCAGATATGTTCAAACTAATGG - Intergenic
1111350088 13:87016722-87016744 AGAACAAATGTCCAAATCAATGG - Intergenic
1111754289 13:92373162-92373184 AGCACAGGTGTCAACACAATTGG + Intronic
1112646682 13:101340685-101340707 AGCACAGTTGTTCAAAAGAATGG - Intronic
1113081127 13:106521294-106521316 AGCACAGAAATTCAAACACACGG + Intronic
1113820888 13:113211728-113211750 AGAATATATGTCCAAACAAAGGG - Intronic
1115965390 14:38881493-38881515 AGTGGAGATGTCCAAACAAAAGG + Intergenic
1116150346 14:41133315-41133337 AGCACAGATTTGCAAATAATAGG + Intergenic
1116381198 14:44270702-44270724 AGAAAAGATGTCAAAATAAAGGG - Intergenic
1117004745 14:51409183-51409205 AGCACAGATCTGCACACAGAGGG - Intergenic
1117243844 14:53863632-53863654 AGCAGTGATGTGAAAACAAAAGG - Intergenic
1118240161 14:64048512-64048534 AACACAGATGTAAAAACAAAGGG - Intronic
1119018197 14:71082223-71082245 AGAACAGATATCAAAACAAACGG - Intronic
1120024752 14:79570355-79570377 AGCACAGCTGTCCACAGAATTGG + Intronic
1120403370 14:84062667-84062689 AACACACAAGTCCAAATAAATGG + Intergenic
1122170232 14:99867173-99867195 AGGACAGATGTGCAGATAAATGG - Intronic
1122322424 14:100863177-100863199 AGCTCAGATGTCCAGAAAGAGGG + Intergenic
1122322454 14:100863463-100863485 AGCGCAGATGTCCAGAAAGAGGG + Intergenic
1122322495 14:100863772-100863794 AGCTCAGATGTCCAGAAAGAAGG + Intergenic
1122322513 14:100863913-100863935 AGCCCAGATGTCCAGAAAGAGGG + Intergenic
1202879076 14_KI270722v1_random:40586-40608 ATCACAGATGTCGAAACAAATGG - Intergenic
1125278160 15:38015569-38015591 AACACTTATGTCCACACAAAAGG + Intergenic
1125362272 15:38876652-38876674 AGCAAAGATGTGCAAATACAAGG - Intergenic
1127609883 15:60626636-60626658 AGCCCAAATGTCCTATCAAATGG - Intronic
1127679505 15:61279538-61279560 AGGACAGCTTTCCAAATAAAGGG + Intergenic
1131277180 15:90991962-90991984 AGCACTGAGGTCAAAAGAAATGG - Intronic
1131760233 15:95614807-95614829 TGTGCAGATGTCCAAACACATGG - Intergenic
1133842381 16:9421451-9421473 TGGACAGAGGTCAAAACAAATGG - Intergenic
1134806299 16:17128741-17128763 AGCAGAGATGTCCGGAGAAAAGG + Intronic
1135221407 16:20617298-20617320 AACACAGAAATACAAACAAATGG - Intronic
1138086920 16:54141873-54141895 TGAATAAATGTCCAAACAAATGG - Intergenic
1139533647 16:67557840-67557862 GGAACAGAAGGCCAAACAAAAGG - Intergenic
1140555550 16:75916974-75916996 AGCCCAGATGTCCAAAATCAAGG + Intergenic
1141698541 16:85632080-85632102 GGCACAGACATCCAAACAAGCGG - Intronic
1142124843 16:88405144-88405166 GGAACAGATGTCCACACAGAGGG + Intergenic
1144885882 17:18460948-18460970 AGCACAGTAGTCCAAAAATAAGG + Intergenic
1145146330 17:20483424-20483446 AGCACAGTAGTCCAAAAATAAGG - Intergenic
1146148351 17:30442862-30442884 ACCACACATATCCAAACAAAAGG - Intronic
1146519381 17:33514567-33514589 AGGACAGAAGTCCAAACAGGTGG - Intronic
1150944991 17:69735366-69735388 ATCACTCATCTCCAAACAAAGGG + Intergenic
1151413114 17:73944064-73944086 AGCTCAGATGCCCAAATAAGTGG + Intergenic
1151430856 17:74061750-74061772 AGCATAGGTGTCGAAACATAGGG - Intergenic
1151874163 17:76857079-76857101 AGCAGAGATGGACCAACAAAGGG + Intergenic
1153115872 18:1655372-1655394 AGCAGAGATGGGAAAACAAAGGG + Intergenic
1153210169 18:2754078-2754100 GGCAAAGATGTCTAAACAAAAGG - Intronic
1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG + Intronic
1155107892 18:22685942-22685964 AGTACAGAAGTCCAAACACATGG + Intergenic
1155197097 18:23485590-23485612 GGCACAGCTGACCAAGCAAAAGG + Intronic
1156024553 18:32637005-32637027 AACAAAGAGGTCTAAACAAATGG + Intergenic
1156266898 18:35497540-35497562 AGCCCATGTGTCCAAACGAAGGG + Intronic
1157514732 18:48302818-48302840 AGCACAGAACTGCAAAGAAATGG - Intronic
1157917829 18:51686053-51686075 AGCACAGTGGTCCAAACATCAGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1159542565 18:69796716-69796738 AGCACACATGTCCAGAAAAGAGG + Intronic
1202654697 1_KI270708v1_random:9594-9616 ATCACAGATGTCGAAACAAATGG - Intergenic
925067887 2:943219-943241 AGCACAGATTCCCAAACGCATGG - Intergenic
925776064 2:7337373-7337395 ATAACAGAAGTCCATACAAATGG + Intergenic
926427291 2:12750662-12750684 AGTAGAGATGGCCAAATAAAGGG - Intergenic
926450303 2:12995210-12995232 AGCACAGATTTGGAAAAAAAAGG + Intergenic
927016421 2:18967237-18967259 ATCACAGATTCACAAACAAATGG - Intergenic
930634595 2:53790088-53790110 AACACAAATGTCCAACCAACTGG - Intronic
931998779 2:67864402-67864424 ACCGCAGAGGTCAAAACAAAAGG + Intergenic
932126802 2:69152043-69152065 AGCACAGTTTGCCAAGCAAATGG - Intronic
932136783 2:69238204-69238226 AGCATAGTTGTCCAATCAACTGG + Intronic
932270736 2:70407016-70407038 ATCACAGATGCACAAACAAATGG + Intergenic
932838863 2:75062765-75062787 AGTGCAGCTGTGCAAACAAAAGG - Intronic
934816685 2:97333248-97333270 AGCAGAAATGTCAAAAAAAAAGG - Intergenic
934821011 2:97375236-97375258 AGCAGAAATGTCAAAAAAAAAGG + Intergenic
935360582 2:102243390-102243412 AGCTCAGAGCTCCAAACAAAAGG + Intergenic
935720409 2:105974349-105974371 AGCTCAAATGTCCAGAAAAAGGG - Intergenic
938369856 2:130762257-130762279 ACGACAGATGCCCCAACAAAGGG + Exonic
939253793 2:139717428-139717450 GGCAGAGATTTCCAAGCAAAGGG - Intergenic
941787431 2:169513629-169513651 AGAATAGATGTGCATACAAATGG - Intronic
943472729 2:188314862-188314884 AGCACGGATGGCTAGACAAAGGG - Intronic
944463070 2:199972423-199972445 ATCACAGATGTCCTTATAAAAGG + Intronic
945186449 2:207144619-207144641 AGCACAGATCTTCAAAGAAAGGG - Intronic
946987872 2:225293241-225293263 AGCACTGATGTCAAGAGAAAGGG - Intergenic
948300377 2:236901997-236902019 ACCACAGACGTCTACACAAATGG + Intergenic
948766966 2:240227357-240227379 AGCACAGCTGGCCAAACAGCCGG - Intergenic
948933532 2:241148357-241148379 AGCACAGCTGTACAACAAAAAGG + Intronic
949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG + Intronic
1170143918 20:13152432-13152454 AGCAGGGACGTCCAAAAAAATGG + Intronic
1170977883 20:21183568-21183590 AGCACATATGTAAAAAGAAATGG - Intronic
1174250631 20:49216990-49217012 GGCACAGATCTCCAAAGAGATGG + Intergenic
1174311544 20:49659595-49659617 AGTAAAGATTGCCAAACAAAAGG + Intronic
1175091334 20:56507026-56507048 AACTCAGATGTCCAAAGAATGGG - Intronic
1175254447 20:57631028-57631050 AGCCTAGATATCCAAACAAAAGG + Intergenic
1175611104 20:60352039-60352061 AGCACAGATGTCCAATGCAAGGG - Intergenic
1176377755 21:6094883-6094905 AGCACACATGTGCACACACACGG + Intergenic
1176640379 21:9298046-9298068 ATCATAGATCTCGAAACAAATGG - Intergenic
1177369975 21:20189654-20189676 AGCACAGGAGTCAAAACAGAAGG - Intergenic
1178332090 21:31706707-31706729 GACAAAGATGTGCAAACAAAAGG + Intronic
1178925692 21:36773250-36773272 AGCACAGATTGGCAAAGAAAGGG + Intronic
1179039913 21:37793430-37793452 AGAACAGATGTGCCAAGAAAGGG - Intronic
1179745719 21:43443361-43443383 AGCACACATGTGCACACACACGG - Intergenic
1180349407 22:11787430-11787452 ATCATAGATGTCGAAAAAAATGG - Intergenic
1180388804 22:12204802-12204824 ATCACAGATGTCGAAATAAATGG + Intergenic
1181558601 22:23686553-23686575 AGCTCAGAGGTCTCAACAAATGG + Intergenic
1181726813 22:24817111-24817133 ACCACAGATGTCCACATCAAAGG + Intronic
1182396653 22:30041034-30041056 AGCACAACTGTCCAACCACAGGG + Intergenic
1183597172 22:38819533-38819555 AGCCCAGATTTCAAACCAAAGGG - Exonic
1184401870 22:44279156-44279178 AGCCAAGCTGTCCAAACAAACGG + Intronic
949433508 3:4003848-4003870 AGTGCAGATGTACAAAGAAAGGG + Intronic
949616972 3:5764546-5764568 AGCAAAGATGTCCAAAGTTATGG + Intergenic
950887567 3:16374776-16374798 AGCACGGACCTCCAACCAAAAGG + Intronic
951707941 3:25562670-25562692 AGCTCATATGTCCAAAGAAAAGG + Intronic
951811413 3:26704767-26704789 AGAACAAATGACAAAACAAAAGG - Intronic
952585564 3:34887945-34887967 AGCACGTATTTCCAAACACAGGG - Intergenic
952935809 3:38397522-38397544 AGAACAGAAGTTGAAACAAAGGG + Intronic
953039872 3:39246386-39246408 AGCACAGATGGACACAAAAAGGG - Intergenic
953597956 3:44336017-44336039 AGCACAAATATCCACACAAAGGG - Intergenic
953867637 3:46597858-46597880 AAAACAGATGACCAAATAAATGG - Intronic
953984364 3:47429966-47429988 ATCACAGCTTTCCAAACATATGG + Intronic
954038675 3:47867900-47867922 TGCTCAGATGTGCATACAAATGG + Intronic
956192206 3:66618722-66618744 AGGACAGAACTCCAAACCAATGG - Intergenic
956359144 3:68428071-68428093 AGCAGAGATGCCCAAACATGTGG + Intronic
957099805 3:75812706-75812728 ATCATAGATGACAAAACAAATGG + Intergenic
959195217 3:103171775-103171797 ATCACAGTTGTCTCAACAAATGG - Intergenic
960501270 3:118441916-118441938 CGCACAGATGTGAAAAGAAAGGG - Intergenic
960941573 3:122938313-122938335 AGGACAGATGGACAGACAAATGG + Intronic
961846926 3:129773107-129773129 AACACAAATGTCCAAAAAGAGGG + Intronic
962201660 3:133405132-133405154 AGACCAGGTGTCAAAACAAAAGG + Intronic
962813486 3:138978373-138978395 AGCACAGATGCTCACACCAATGG - Intergenic
963570527 3:146989138-146989160 AGGATAGATGTACAAATAAAGGG - Intergenic
966336161 3:178870638-178870660 ACAACAGATGTTCAAACAACAGG + Intergenic
1202746515 3_GL000221v1_random:106977-106999 ATCATAGATCTCGAAACAAATGG + Intergenic
969867174 4:10083610-10083632 ACCAGAGCTGTCCACACAAAAGG + Intronic
972813815 4:42621564-42621586 ATCAGAGATGACAAAACAAATGG + Intronic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
975775737 4:77785175-77785197 AGCACAGATTTTTCAACAAATGG + Intronic
977328061 4:95602228-95602250 AGTATAGAAGTCCAAACAACTGG + Intergenic
977735586 4:100411097-100411119 AGGACAGATTTCCTAACAAGTGG - Intronic
977816072 4:101415781-101415803 AGCAAATATGACCAAAAAAAAGG + Intronic
978671979 4:111260130-111260152 AACACAAATGTGCAAACATATGG + Intergenic
980028152 4:127791262-127791284 AGCACAGATGTCCAACCATTTGG + Intronic
980825803 4:138071125-138071147 AGCAAAGATATGGAAACAAATGG + Intergenic
982624421 4:157748199-157748221 AGCACAAATGCACAAAAAAATGG + Intergenic
984304318 4:177967461-177967483 AACACAGTGGTACAAACAAAAGG - Intronic
984519515 4:180785151-180785173 ATCACAGAGGTGCAGACAAAAGG - Intergenic
986656898 5:10021615-10021637 GGCACAGATGTACATCCAAAAGG + Intergenic
987342916 5:16954292-16954314 TGCACATATGTCCAAATTAAGGG + Intergenic
987421342 5:17723972-17723994 AGAACAGATGCCCACACAGATGG - Intergenic
987984272 5:25125470-25125492 GTCACATATGTCCAAACAAAAGG - Intergenic
989533434 5:42535804-42535826 ATCGTAGATGACCAAACAAATGG - Intronic
990985898 5:61640510-61640532 AGCAGAGATGTCCAGACTGAAGG - Intronic
992956299 5:81912125-81912147 AGCACAAGTGACCAAAGAAAAGG + Intergenic
993266087 5:85728168-85728190 ATCACAGATGTCCTCATAAAGGG - Intergenic
993950863 5:94173521-94173543 AGGTCAGAAGTCCAAACAACGGG - Intronic
995758332 5:115536673-115536695 AGAACAGAAGTTCAAAAAAAAGG + Intronic
995774282 5:115709198-115709220 AGACCTTATGTCCAAACAAAGGG - Intergenic
997939537 5:138144486-138144508 GGCACAGATGTCGATCCAAATGG - Intronic
998575369 5:143309672-143309694 AACACAGATCTCCAAGTAAAAGG + Intronic
998812360 5:145978995-145979017 AACACAGATATCCTACCAAATGG + Intronic
999186918 5:149718078-149718100 ACAACAGATGTCCAATCAAAAGG - Intergenic
1001917281 5:175572195-175572217 AGCACTGCTGACCAGACAAATGG - Intergenic
1002089290 5:176794983-176795005 AGCACAGCCGTCCACACAATAGG + Intergenic
1004376967 6:15098842-15098864 AGCACAAATGTTCTCACAAATGG - Intergenic
1005031811 6:21516100-21516122 AACACAGATATCCAAACATTAGG - Intergenic
1005709291 6:28488148-28488170 AGCAGTGAGGTCCAAACATAGGG + Intergenic
1005716801 6:28557236-28557258 ATCACAGATGCCAATACAAATGG + Intergenic
1007513252 6:42391015-42391037 AGAACAGAGGTCAGAACAAAAGG + Intronic
1009441206 6:63680890-63680912 AGCACAGACTTCCAGAAAAATGG - Intronic
1009948974 6:70373256-70373278 AGCAAAGGTGACCAAAAAAATGG - Intergenic
1010428502 6:75751710-75751732 AGCCCAGTTGTCTAAACAATGGG - Intronic
1011955011 6:93015800-93015822 GGCACATATTTCCAAACAATTGG + Intergenic
1011973289 6:93256602-93256624 AGGACAGATGTACTAGCAAATGG + Intronic
1012266956 6:97156661-97156683 AACACAGATGTCCAGACCAATGG - Intronic
1013084997 6:106849115-106849137 AGCACACATGCCCAGAGAAAAGG + Intergenic
1015392994 6:132703861-132703883 AGCAAAGATTTCCATGCAAATGG + Intronic
1016988331 6:149911290-149911312 AGCACAGATGGCAAAATAAAAGG - Intergenic
1017106076 6:150889398-150889420 AGCACAGATTGCTAAAGAAAAGG + Intronic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1017637926 6:156461328-156461350 AGCAAAGTTGTCCAAAAATAGGG - Intergenic
1018638289 6:165884039-165884061 AGCACAGATGTCAAAGCAGGTGG + Intronic
1018932972 6:168254092-168254114 AGCACAAGTTTCCAAACATAAGG + Intergenic
1020053220 7:5097309-5097331 AGCATATATATCCAAAGAAAAGG - Intergenic
1021056016 7:16047244-16047266 AGCACAAATGGTAAAACAAATGG + Intergenic
1022409115 7:30122821-30122843 AGAACAGATGTGCAAAGTAAAGG + Intronic
1024473837 7:49790410-49790432 AGAACAGATTTGCACACAAAGGG - Intronic
1024635930 7:51290530-51290552 AACACAGATATCAGAACAAAGGG + Intronic
1025621968 7:63181622-63181644 AGGACAGATGTCTATATAAAAGG + Intergenic
1028200667 7:87957120-87957142 GCCAGAGATGTCTAAACAAAGGG - Intronic
1029539624 7:101174848-101174870 GGCCCAGATGTGGAAACAAAGGG - Intronic
1031378022 7:121051043-121051065 GGCAAAAATGTGCAAACAAAAGG + Intronic
1032801860 7:135323168-135323190 AGCTCACATTTGCAAACAAAAGG - Intergenic
1033722549 7:144076901-144076923 ATAACAGATGTCCTAACAAAAGG - Intergenic
1034844026 7:154426987-154427009 AGCACTGATGCACAAATAAAGGG - Intronic
1035961350 8:4141523-4141545 TTCACACATGTACAAACAAAGGG + Intronic
1035994894 8:4534627-4534649 AGCACACATGGCCATAAAAATGG - Intronic
1036247364 8:7129659-7129681 ATCATAGATGACAAAACAAATGG + Intergenic
1038247491 8:25872487-25872509 TGCACAGATGCACAAACACATGG - Intronic
1038299669 8:26331696-26331718 AGCACGTATCTACAAACAAATGG - Intronic
1038992165 8:32879557-32879579 AGCAGAGATGTTCCTACAAAGGG - Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1039204078 8:35130001-35130023 AAAACATATGTCCACACAAAGGG - Intergenic
1039520160 8:38163890-38163912 AGCACAGATCTCAAGGCAAATGG + Intronic
1042435379 8:68758211-68758233 AGCAAAGAAGGCAAAACAAATGG + Intronic
1043548537 8:81342153-81342175 AACACAGTTGTCCAAACAATAGG + Intergenic
1043951347 8:86312103-86312125 AGCACAGCTGGCCAAGTAAATGG + Intronic
1044332635 8:90939611-90939633 ATCACAAATGTCCAACCAAGAGG + Intronic
1044638028 8:94346996-94347018 ATCACAGATTTGCAGACAAACGG + Intergenic
1045809640 8:106206397-106206419 AGCAGAGATGATTAAACAAATGG + Intergenic
1046508099 8:115162133-115162155 ACCATAAATGTCCAAATAAAAGG - Intergenic
1048488757 8:134872199-134872221 AACACAGATGTCTAAAGAAGGGG - Intergenic
1048727735 8:137406131-137406153 ATCCCAGATGTCCTTACAAAGGG - Intergenic
1049514764 8:143048229-143048251 AGCACATATATCCACAGAAACGG - Intronic
1050260446 9:3836086-3836108 AGCAGACAGGGCCAAACAAAGGG - Intronic
1050803680 9:9647037-9647059 AGCACAGATGGGCAAAGAGATGG - Intronic
1051026276 9:12615536-12615558 AGAACAGATATCCAGGCAAATGG + Intergenic
1051950300 9:22622805-22622827 AGCACAGATGCCAAAGCAGATGG + Intergenic
1053488670 9:38482940-38482962 AGCACTGATGTCTAAAGACATGG - Intergenic
1057065846 9:92050386-92050408 AGCACAGAAGTCCAAAAAAGTGG - Intronic
1057669021 9:97072219-97072241 AGCACTGATGTCTAAAGACATGG - Intergenic
1061735225 9:132650949-132650971 AGCAGAGATATCCAGGCAAAAGG + Intronic
1061830440 9:133289733-133289755 AGCCCAGGTGTCCAAATAACAGG - Intergenic
1062505812 9:136875576-136875598 AGGACAGATGTCCAGAGAGAGGG - Intronic
1062588583 9:137262932-137262954 AGGACAGATGTCCAGAGAGAGGG + Intronic
1062660440 9:137628631-137628653 AGCACAGCTGTCCTATGAAAAGG + Intronic
1203715151 Un_KI270742v1:137070-137092 ATCATAGATCTCGAAACAAATGG + Intergenic
1186915290 X:14212548-14212570 AGGATAGATGTACAAAGAAAAGG - Intergenic
1188924963 X:36028514-36028536 AACACAGATGACACAACAAATGG - Intergenic
1191697251 X:64003014-64003036 AGCAGAGCAGTCCAAGCAAAGGG + Intergenic
1193092995 X:77514101-77514123 ATTAGAGATGTCAAAACAAATGG + Intronic
1196270776 X:113708218-113708240 AGCACAGATGGCTACATAAAAGG - Intergenic
1197114770 X:122818761-122818783 AGCACACCTGTTCTAACAAAGGG + Intergenic
1198708386 X:139474562-139474584 AGCACAGACATTCAAAAAAATGG + Intergenic
1199242389 X:145562614-145562636 AGGACAGATATACAAACCAATGG - Intergenic
1201605473 Y:15779569-15779591 AGCACTGATGTGCAAAGAACTGG - Intergenic
1201893468 Y:18968497-18968519 AGGACAGATGTCCAGGTAAAGGG + Intergenic