ID: 1017403525

View in Genome Browser
Species Human (GRCh38)
Location 6:154091906-154091928
Sequence ATCCATGACCACAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017403525_1017403528 8 Left 1017403525 6:154091906-154091928 CCTTGCCCACTGTGGTCATGGAT 0: 1
1: 1
2: 0
3: 8
4: 204
Right 1017403528 6:154091937-154091959 TTCACAGAAAATTAGCATCATGG 0: 1
1: 0
2: 0
3: 20
4: 283
1017403525_1017403529 14 Left 1017403525 6:154091906-154091928 CCTTGCCCACTGTGGTCATGGAT 0: 1
1: 1
2: 0
3: 8
4: 204
Right 1017403529 6:154091943-154091965 GAAAATTAGCATCATGGAAAAGG 0: 1
1: 0
2: 0
3: 44
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017403525 Original CRISPR ATCCATGACCACAGTGGGCA AGG (reversed) Intronic
900798245 1:4722532-4722554 ATGCATCACCACAGTCTGCATGG + Intronic
902513273 1:16977363-16977385 ACCCATGACCAGGGTGGGGAAGG - Intronic
904347120 1:29879792-29879814 ATTTATGTCCACAGTGGGGAAGG + Intergenic
905539033 1:38745552-38745574 AGGCATGTCCACAGTGGTCATGG - Intergenic
905777508 1:40678514-40678536 AGCAATGAGCACAGTTGGCAAGG - Intergenic
906705287 1:47890338-47890360 CTCCATGACCACGCTGGTCATGG - Intronic
910370753 1:86512977-86512999 ATCCATGAACAAAGTGGCCATGG + Intergenic
910830984 1:91462575-91462597 ACCCATGAACAAAGTGGCCATGG - Intergenic
911109055 1:94163858-94163880 ACCCATGAACAAAGTGGCCATGG - Intronic
911883686 1:103271308-103271330 ACCCATGAACACAGTGGCCATGG + Intergenic
916459424 1:165007962-165007984 ATTCATTACAACAGAGGGCACGG + Intergenic
917557355 1:176103461-176103483 ATGCATGCCCAGAGAGGGCATGG + Intronic
920826102 1:209425542-209425564 GTCCATGACCATAATGGGGATGG - Intergenic
921203616 1:212829421-212829443 AACCATCACCACTGTGGGGATGG + Intergenic
921622372 1:217340047-217340069 ATCAATGACCAAGGTGGACAAGG - Intergenic
924147268 1:241089193-241089215 CTCCATGACCAGAGTTGCCATGG + Intronic
1062900313 10:1139458-1139480 ATGTATGACCAAAGTGGGGAAGG + Intergenic
1071032857 10:81205561-81205583 CCCCATGAACAAAGTGGGCATGG + Intergenic
1073027476 10:100498438-100498460 GTGCTTGATCACAGTGGGCAGGG + Intronic
1073891371 10:108106141-108106163 ATTCATGAGCCCATTGGGCAGGG - Intergenic
1073997505 10:109332713-109332735 CTCCAGTACCACAGTGGACAAGG - Intergenic
1074490725 10:113937114-113937136 ATCCCTGCCATCAGTGGGCAAGG - Intergenic
1074788451 10:116862999-116863021 ATCCATGTCCTCAGTGGCTATGG + Intronic
1075835495 10:125449366-125449388 AACCATGACCACAGTGGATACGG - Intergenic
1075949486 10:126464467-126464489 TTTCAAGACCACTGTGGGCAAGG - Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1076881001 10:133239229-133239251 AGACTTGACCACAGTGGGCCTGG + Intronic
1076935544 10:133566090-133566112 CTCCATGCCCACAGTGGCCGAGG + Intronic
1077213594 11:1384746-1384768 AGCCGTGACCACAGCGGGCCAGG - Intergenic
1078759191 11:14238197-14238219 ATCCATGATCAGAGAGGGAAAGG - Intronic
1079480746 11:20877076-20877098 ACCCATTACCATATTGGGCAGGG + Intronic
1080689616 11:34545442-34545464 ATCAATTATCAGAGTGGGCAAGG - Intergenic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1088288311 11:108209592-108209614 ATCAATTACCACATTGGGCCAGG + Intronic
1088329475 11:108635409-108635431 ATTCTTGACCACAGTGGCCCTGG + Intergenic
1088357597 11:108960076-108960098 ATGGCTGACCACAGTGGGGACGG + Intergenic
1090401236 11:126449565-126449587 GTCCATGACCTCAGAGGCCAGGG + Intronic
1093170252 12:15852315-15852337 ACCCATGCCCACAGAGAGCATGG + Intronic
1093964652 12:25311773-25311795 ACCCATGAACAAAGTGGCCATGG + Intergenic
1094427051 12:30326978-30327000 ACCCATGAATACAGTGGCCATGG - Intergenic
1095844275 12:46729152-46729174 ACCCATGAACAAAGTGGCCATGG - Intergenic
1097210876 12:57368680-57368702 ATCCATGACTCCACTGGGAAAGG + Intronic
1099689885 12:85938843-85938865 GTCCATGAACAAAGTGGCCATGG + Intergenic
1102057860 12:109910266-109910288 TGCCCTGACCGCAGTGGGCAGGG - Intronic
1103034549 12:117646236-117646258 ATCCATGAATACAGAGGGCCAGG + Intronic
1103590704 12:121990241-121990263 ATCCCTGGCCACTGTGTGCATGG + Intronic
1104745684 12:131208755-131208777 TTCCACGAGCACAGTGGGCTGGG - Intergenic
1106434322 13:29710468-29710490 ATCCCTGACCACACTGGGATAGG - Intergenic
1108582748 13:51840640-51840662 TTCCAGGAGAACAGTGGGCAGGG - Intergenic
1108705310 13:52980188-52980210 ATACATGCCTACAGTGGGCCAGG + Intergenic
1109895917 13:68689709-68689731 ATCCATGAAAACAGGGGGCGGGG - Intergenic
1112057610 13:95705195-95705217 ACCCATGAACAAAGTGGCCATGG - Intronic
1114905281 14:27119737-27119759 GTCCATGAACAAAGTGGCCATGG - Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117810022 14:59536060-59536082 ATCTATGACAAGATTGGGCAGGG - Intronic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1124405237 15:29385858-29385880 ATCTGAGACCATAGTGGGCATGG + Intronic
1125550439 15:40540746-40540768 AACCTTGACCACAGTGTGAAAGG + Intronic
1125892929 15:43279552-43279574 GTCCATGAACACAGTGGGGTGGG - Intronic
1126734049 15:51713920-51713942 ATCCATGACATCACTGAGCAGGG - Intronic
1127453165 15:59136016-59136038 GTCCAAGACCAAGGTGGGCAGGG + Exonic
1127834186 15:62776898-62776920 AGCCATGAGCAAGGTGGGCATGG + Exonic
1129717088 15:77858816-77858838 ATCCATGCCCACAGCTGGGAAGG + Intergenic
1129723706 15:77891201-77891223 CTCCAAGTCCCCAGTGGGCAGGG + Intergenic
1130398784 15:83529818-83529840 AGCAATGATGACAGTGGGCAGGG + Intronic
1132288549 15:100683515-100683537 ATCCATGAGCACAGGGTGCCTGG - Intergenic
1132422533 15:101684660-101684682 ACTCATGAGCAGAGTGGGCAGGG - Intronic
1133825903 16:9278043-9278065 TTCCATGACCACACTGCACAGGG - Intergenic
1136159964 16:28413600-28413622 ATCCAGGACCATACTGTGCATGG + Intergenic
1136203124 16:28701692-28701714 ATCCAGGACCATACTGTGCATGG - Intronic
1136556907 16:31012269-31012291 ATCCATGACTACAGTGGGCATGG + Intergenic
1139048410 16:63091921-63091943 ATTCATGAAGACAGTGGTCATGG - Intergenic
1142010694 16:87712338-87712360 AGCCACGCCCACACTGGGCATGG - Intronic
1143898376 17:10154959-10154981 ACCCATGTCCACAGTCTGCATGG + Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144862170 17:18311940-18311962 CTCCATGACAACAGGGGCCAGGG - Intronic
1146836467 17:36114796-36114818 ACCCATGAACAAAGTGGCCATGG + Intergenic
1146860241 17:36291221-36291243 AACCATGACCAGGCTGGGCATGG - Intronic
1147090567 17:38095315-38095337 AACCATGACCAGGCTGGGCATGG - Intergenic
1147106646 17:38225211-38225233 AACCATGACCAGGCTGGGCATGG + Intergenic
1148422876 17:47563320-47563342 AACCATGACCAGGCTGGGCATGG - Intronic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152334987 17:79695621-79695643 TTCCATGACAACAGCAGGCAGGG + Intergenic
1152383604 17:79955273-79955295 CTCCATGACCACACAGGGCCTGG - Intronic
1153248421 18:3096108-3096130 TTGAATGTCCACAGTGGGCACGG + Intronic
1156998685 18:43498547-43498569 GTCCATGAACAAAGTGGCCATGG + Intergenic
1157620981 18:49017406-49017428 AGCCATGACCTCAGTGCTCATGG + Intergenic
1159878731 18:73837791-73837813 AACCCTGACCACAGGGAGCAAGG - Intergenic
1160092556 18:75840833-75840855 ACCCATGAACAAAGTGGCCATGG + Intergenic
1162616023 19:11800817-11800839 GTTCAAGACCAGAGTGGGCAGGG + Intronic
1163787261 19:19281217-19281239 ATCCATGTCCTCAGGGAGCATGG - Intronic
1164098021 19:22029295-22029317 ATCAATGACACCTGTGGGCAGGG + Intergenic
1164117945 19:22240187-22240209 ATCAATGACACCTGTGGGCAGGG + Intergenic
1164181638 19:22824199-22824221 AACAATGCCCACTGTGGGCAAGG - Intergenic
1165099216 19:33428564-33428586 ATCCAAAACCACCGTGGGCCAGG + Intronic
1166826021 19:45609695-45609717 GGCCCTGACCACAGGGGGCAAGG - Exonic
926670282 2:15570668-15570690 ATTCATGTCCACAGGCGGCAAGG + Intergenic
928891163 2:36204855-36204877 ATCCTGCACCACAGTGGCCAAGG - Intergenic
929454519 2:42056376-42056398 ATCCATGGCTAGAGTGGGGAGGG - Intronic
929994136 2:46814603-46814625 TTCCATCACCACACTGGCCATGG - Intergenic
932870588 2:75394265-75394287 GCCCATGACCAAAGTGGCCATGG - Intergenic
933629433 2:84639133-84639155 CACCATGCCCACAGTGGGTATGG - Intronic
933850875 2:86365523-86365545 AGCCCTGACCACAGAGGACATGG - Intergenic
933883398 2:86694868-86694890 ATCCTTGACAACACTTGGCATGG - Intronic
936446838 2:112602680-112602702 ATCCCTGCCTAGAGTGGGCACGG + Intergenic
938100381 2:128493965-128493987 ATACATGACAACCGTGGCCATGG + Intergenic
940171196 2:150831891-150831913 ACCCATGAACAAAGTGGCCATGG - Intergenic
940972055 2:159905089-159905111 GTCCCTGACCACAGTGCGCCAGG - Intergenic
942384975 2:175432937-175432959 ACCGATGACCACAGTGGTGAGGG + Intergenic
943383958 2:187180272-187180294 GCCCATGAACAAAGTGGGCATGG - Intergenic
1170695003 20:18650079-18650101 ATGCACCACCACAGTGGGCTAGG - Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1173090630 20:39967612-39967634 GTGCATGAACACAGGGGGCATGG - Intergenic
1174524661 20:51161348-51161370 ATGCATGCCTACATTGGGCAGGG - Intergenic
1178605260 21:34030720-34030742 ATTCTTGACCCCAGTGGGAAAGG + Intergenic
1179415030 21:41191718-41191740 GTCCATGAACAAAGTGGCCATGG - Intronic
1181529046 22:23505740-23505762 TTCCATGTCCACTGTGTGCAGGG - Intergenic
1181620945 22:24090800-24090822 ATCCAGGACCACAGAGAGGAGGG + Intronic
1182325699 22:29511151-29511173 AGCCATGACGACAGTGTGGAGGG - Exonic
1184603452 22:45557547-45557569 ACCCATGAACAAAGTGGCCATGG - Intronic
949417465 3:3830070-3830092 GTCCATGAACAAAGTGGCCATGG - Intronic
950148126 3:10666268-10666290 AGAGATGACCAGAGTGGGCACGG + Intronic
950195535 3:11006645-11006667 ATCCCTCTCCACTGTGGGCATGG - Intronic
951970654 3:28441068-28441090 ACCCATGAACAAAGTGGCCATGG - Intronic
952003018 3:28808788-28808810 ACCCAAGACCATAGAGGGCACGG - Intergenic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
955436829 3:58909214-58909236 ATGCATGTTCACAGTGGGGAAGG + Intronic
955857962 3:63294914-63294936 ATCCATTTCCAAAGTAGGCATGG - Intronic
956438288 3:69255833-69255855 ATCGATGACCACAGATGGAAAGG + Intronic
956737649 3:72250458-72250480 ATCCACCTCCACACTGGGCAGGG - Intergenic
957459815 3:80501749-80501771 GAACATGACCACAGTGTGCATGG - Intergenic
957754700 3:84470246-84470268 ACCCATGAACAAAGTGGCCATGG + Intergenic
957990890 3:87626136-87626158 ATGCATTACCACATTTGGCATGG - Intergenic
958762040 3:98320641-98320663 ACTCATGAACACAGTGGCCATGG - Intergenic
960005977 3:112781654-112781676 GCTCATGACCACAGTGGGTAAGG - Intronic
960540167 3:118853146-118853168 CTCCATGACCTCAGTTGGCCTGG - Intergenic
961653848 3:128430776-128430798 ATCCTTAGCCAAAGTGGGCACGG + Intergenic
964078640 3:152723773-152723795 ATAATTGAACACAGTGGGCAAGG + Intergenic
964679124 3:159318095-159318117 ACCCATGAACAAAGTGGCCATGG - Intronic
965486458 3:169284346-169284368 ATCCCTGATCACTCTGGGCAGGG + Intronic
966904446 3:184511669-184511691 CTCCATGAACACAGTAAGCACGG - Intronic
968477297 4:818007-818029 ATCCCTGAGCGCATTGGGCAAGG + Intronic
969354064 4:6614813-6614835 AGCAATGACCAAGGTGGGCAAGG + Intronic
970170369 4:13283428-13283450 ATCCATGACCACAGTAAGGAGGG + Intergenic
970582914 4:17489920-17489942 ATCCCTGCCCACAGGGAGCAGGG - Intronic
971120092 4:23694533-23694555 ATCTCAGACCAGAGTGGGCAGGG + Intergenic
971687276 4:29786269-29786291 GCCCATGAACACAGTGGCCATGG - Intergenic
978585362 4:110270921-110270943 ATCCATCACCACAGTGGCTGGGG - Intergenic
978898955 4:113925994-113926016 GTCCATGAACAAAGTGGCCATGG - Intronic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
981982576 4:150811798-150811820 ATCATTTAGCACAGTGGGCAGGG - Intronic
982301014 4:153879570-153879592 ATCCATAAGCACACTGAGCAAGG - Intergenic
986531290 5:8739504-8739526 ACCCATGAACAAAGTGGCCATGG - Intergenic
988107867 5:26773360-26773382 ACCCATGAACAAAGTGGCCATGG + Intergenic
988686991 5:33535064-33535086 ATTCTTGACCACAGTGGGATTGG - Intronic
989762993 5:45042586-45042608 AACAAGGACCACAGGGGGCACGG + Intergenic
992243069 5:74790671-74790693 GTCCATGAACAAAGTGGCCATGG + Intronic
995373618 5:111449467-111449489 GACCATCACCACAGAGGGCAAGG + Intronic
997390641 5:133512099-133512121 ATGCAGGCCCACACTGGGCAAGG + Intronic
1000683618 5:164219533-164219555 ATCCTTGACCACGTTTGGCATGG + Intergenic
1001881334 5:175246758-175246780 AGCCATGACCACAGAGCCCATGG - Intergenic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1004096511 6:12560287-12560309 ATCCAGGCCTCCAGTGGGCAGGG - Intergenic
1007750755 6:44069730-44069752 TTCCATGACCAGAGTGAGAAGGG - Intergenic
1010107837 6:72189752-72189774 GCCCATGAACACAGTGGCCATGG - Intronic
1011492873 6:87910613-87910635 ATCCATGGCCACAGTTGTCCTGG - Intergenic
1012840460 6:104323062-104323084 ATACATAACCACAGTGGGAAGGG + Intergenic
1016594642 6:145785701-145785723 ATTCATGAACAAAGTGGTCATGG + Intergenic
1017403525 6:154091906-154091928 ATCCATGACCACAGTGGGCAAGG - Intronic
1017558582 6:155602015-155602037 CTCCCAGACCACAGTGGGCTTGG + Intergenic
1023529517 7:41137755-41137777 ATCCACACCCCCAGTGGGCATGG - Intergenic
1024355395 7:48409436-48409458 ATCAGTGAGCCCAGTGGGCATGG - Intronic
1025951920 7:66152128-66152150 GACCATGAGCACAGTGGGCAGGG + Intronic
1028560110 7:92165933-92165955 ATCCATGTTCACAGTGAGAATGG - Intronic
1030146098 7:106357614-106357636 CTCCATGACCTAGGTGGGCAGGG - Intergenic
1031135384 7:117878726-117878748 ATCCATGGCCACATTGGGTGAGG - Intergenic
1031412652 7:121458044-121458066 ATCCCTGACCACATTGGTGAGGG + Intergenic
1031474345 7:122204543-122204565 ACCCATGAACAAAGTGGCCATGG - Intergenic
1033651664 7:143348235-143348257 ATCGATGATCACAGAGGGAAAGG + Intronic
1034679844 7:152920359-152920381 ATCCATGTGCTCAGTGGCCAAGG + Intergenic
1038663152 8:29514386-29514408 ATCCATGAAGACAGCGTGCATGG + Intergenic
1039895088 8:41711496-41711518 ACCCAAGGCCACAGTAGGCAAGG + Intronic
1040277727 8:46022494-46022516 CTCCATGACCACATGGGGCCTGG + Intergenic
1042632674 8:70836997-70837019 CTACTTGACCACAGTGGTCAAGG + Intergenic
1044110710 8:88269405-88269427 AGCCATAACAAAAGTGGGCAAGG + Intronic
1044487046 8:92766365-92766387 GTCCATGAACAAAGTGGCCATGG - Intergenic
1045171879 8:99679800-99679822 ATTCATGATGACAGTGGACAAGG - Intronic
1046124150 8:109883075-109883097 TTCAATGGCCACATTGGGCATGG + Intergenic
1047902211 8:129435612-129435634 AGCTATGAGCCCAGTGGGCAGGG + Intergenic
1048843817 8:138587988-138588010 ATGCAGGATCACAGTGGGGAGGG - Intergenic
1049436605 8:142589038-142589060 GGTGATGACCACAGTGGGCAGGG + Intergenic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1053365247 9:37518222-37518244 ATCTATGACAACAGAGGCCACGG - Exonic
1058715622 9:107719698-107719720 ACCAGTGACCACAGTGGGCTTGG - Intergenic
1059254606 9:112918181-112918203 ATCCATGACGACAGTGAGGAAGG - Intergenic
1059322008 9:113477247-113477269 TTTCAGGACCACAGTGGCCATGG - Intronic
1061255067 9:129450480-129450502 TTCCATGTCCACTGTGTGCAAGG + Intergenic
1061699132 9:132402042-132402064 ATCCAAGCCCACAGTAGGCTGGG + Exonic
1187195264 X:17077604-17077626 ATCCATAACAAGTGTGGGCAAGG - Intronic
1187483764 X:19682797-19682819 ATGCATGATGACACTGGGCAAGG + Intronic
1187524032 X:20037944-20037966 GTCCATGAACAAAGTGGCCACGG + Intronic
1189931251 X:46013562-46013584 AGCCACAACCACAGTGGGAATGG + Intergenic
1190370352 X:49734387-49734409 ATGCCTGCCCACAGTGGGGAGGG - Intergenic
1191658685 X:63628991-63629013 GTCCATGAACAAAGTGGCCATGG - Intergenic
1191769388 X:64739281-64739303 ATCCATGAACAAAGTGGCCATGG - Intergenic
1195070963 X:101279174-101279196 ATCCATGAACACAGTTGCCTTGG - Intronic
1195809681 X:108816032-108816054 ACCCATGAACAAAGTGGCCATGG - Intergenic
1196593973 X:117521794-117521816 ATCCTTGCCCAGAGTGGGAATGG - Intergenic
1199679606 X:150215755-150215777 ATCCAGGCCCACAGGAGGCAGGG - Intergenic
1199695625 X:150341294-150341316 ATCCAGGCCCACAGGAGGCAGGG + Intergenic
1201193610 Y:11470602-11470624 ACCCATGAACATAGTGGCCATGG - Intergenic
1201796558 Y:17902820-17902842 GTCCATGAACAAAGTGGCCATGG - Intergenic
1201804997 Y:18003165-18003187 GTCCATGAACAAAGTGGCCATGG + Intergenic
1202018301 Y:20435074-20435096 ATCCATGTCCTCACTGGGCCTGG + Intergenic