ID: 1017404540

View in Genome Browser
Species Human (GRCh38)
Location 6:154104141-154104163
Sequence CACAAGAGCCCCTAATAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 9, 3: 64, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017404540_1017404543 18 Left 1017404540 6:154104141-154104163 CCTAGCTATTAGGGGCTCTTGTG 0: 1
1: 1
2: 9
3: 64
4: 179
Right 1017404543 6:154104182-154104204 TCAGTCAGAAAGCATCAGTATGG 0: 32
1: 36
2: 49
3: 40
4: 239
1017404540_1017404545 24 Left 1017404540 6:154104141-154104163 CCTAGCTATTAGGGGCTCTTGTG 0: 1
1: 1
2: 9
3: 64
4: 179
Right 1017404545 6:154104188-154104210 AGAAAGCATCAGTATGGCGAGGG 0: 4
1: 28
2: 32
3: 64
4: 177
1017404540_1017404544 23 Left 1017404540 6:154104141-154104163 CCTAGCTATTAGGGGCTCTTGTG 0: 1
1: 1
2: 9
3: 64
4: 179
Right 1017404544 6:154104187-154104209 CAGAAAGCATCAGTATGGCGAGG 0: 3
1: 24
2: 37
3: 59
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017404540 Original CRISPR CACAAGAGCCCCTAATAGCT AGG (reversed) Intronic
901031829 1:6311555-6311577 CACAAGAGACCCCAATAGCTGGG - Intronic
901032968 1:6319066-6319088 TGCAAGAGCCCCAAATATCTTGG + Intronic
901976012 1:12944632-12944654 CACCAGACACCCAAATAGCTGGG + Intronic
902009160 1:13257133-13257155 CACCAGACACCCAAATAGCTGGG - Intronic
902450213 1:16491879-16491901 CACCCCAGCCCCTACTAGCTGGG + Intergenic
903899816 1:26635772-26635794 TACAAGAGACCCTAGTAGTTAGG + Intergenic
904542821 1:31244945-31244967 TACACTAACCCCTAATAGCTAGG - Intergenic
904729711 1:32580432-32580454 CTCAAGCTTCCCTAATAGCTGGG - Intronic
905428891 1:37907351-37907373 TACAAGAGACCCTCATAGTTAGG + Intronic
908239785 1:62179097-62179119 TACAAGAGACCCTAATAGGTAGG - Intergenic
911278701 1:95896248-95896270 TACAAGAGACCTTAATAGTTAGG - Intergenic
912377827 1:109226567-109226589 CACCACAGCCTCTAATACCTGGG + Intronic
912811821 1:112800840-112800862 CACAAGCGCCCCTGATAATTAGG + Intergenic
915372834 1:155365859-155365881 TACAAGAGACCCTAATAGGCAGG + Intronic
915373353 1:155370827-155370849 CCAAAGAGCCCCTAAAAGCTGGG - Exonic
916116738 1:161491213-161491235 AACAAGAGACCCTAATAGGCAGG + Intergenic
918589734 1:186227626-186227648 CACAAGAAACCCTCATAGTTCGG + Intergenic
920794361 1:209124274-209124296 CACATGAGCCCTTAAAAGCTCGG + Intergenic
921060087 1:211578361-211578383 CACCAGAGCCCCCATTACCTCGG + Exonic
921535910 1:216349207-216349229 GACAAGAGACCCTAATTGTTAGG + Intronic
922959335 1:229632851-229632873 CACAAGTGCCACTAGTGGCTTGG + Intronic
1064610266 10:17092225-17092247 TACAAGAGACCCTAATAGTTAGG + Intronic
1067822712 10:49543967-49543989 TACAAGAGACCATAATAGTTAGG - Intergenic
1070494646 10:77010469-77010491 AACAAGAGCCTCTAATTTCTTGG - Intronic
1070909795 10:80108043-80108065 TAAAAGAGACCCTAATAGCTAGG + Intergenic
1070985047 10:80681484-80681506 CACAAGACCCCCTAGTTTCTTGG - Intergenic
1071392047 10:85184968-85184990 CACAAGAGACTCTAATAGTTAGG - Intergenic
1072822634 10:98573129-98573151 CACAAGAGCCACTATGAGATAGG - Intronic
1073690414 10:105802018-105802040 CAGAAGTGCCTCTAATAGCTGGG + Intergenic
1077873991 11:6288075-6288097 CACAAGAGGCTCTAATAGCTAGG + Intergenic
1078169909 11:8921756-8921778 CACTACAGCCCCCAGTAGCTGGG + Intronic
1079254753 11:18818428-18818450 TACAAGAGACGCTAATAGTTAGG - Intergenic
1079753648 11:24229155-24229177 TACAAGAGACCCTAATAGGCAGG + Intergenic
1079947928 11:26766814-26766836 TACAAGAGGCCCTAAAAGTTAGG + Intergenic
1080058192 11:27929161-27929183 TACAAGAGACTCTAATAGTTAGG - Intergenic
1082693050 11:56328477-56328499 TACAAGAGACCCTAATAGGTAGG - Intergenic
1083001265 11:59293051-59293073 TACAAGAGACCCTAACAGTTAGG - Intergenic
1083579607 11:63816588-63816610 CACAGGAGGCCCTAATACCTGGG - Intronic
1083789840 11:64977333-64977355 CACTTGAGCCTCTAACAGCTTGG - Intergenic
1087519638 11:99215438-99215460 CATAAGACCTCCTAATGGCTTGG + Intronic
1089822319 11:121239844-121239866 TACAAGAGACCCTAATGGTTAGG + Intergenic
1089826818 11:121285138-121285160 TACAAGAGACCCTAATAGTTAGG + Intergenic
1092987684 12:13862354-13862376 CACAAGAGCACTTAATAAGTGGG + Intronic
1094594434 12:31851883-31851905 CACAAAAGACCCTAATAGTTAGG + Intergenic
1095602742 12:44032780-44032802 TACAAGAGACCCTAATAGTGAGG + Intronic
1097117134 12:56705797-56705819 CACAAGAGATCCTAATAGTTAGG - Intergenic
1098316987 12:69203065-69203087 TACAAGAGACACTAATAGTTAGG + Intergenic
1098744436 12:74218142-74218164 AGCAAAAGCCCCTAATAGGTGGG - Intergenic
1099244125 12:80173843-80173865 TACAAGATGCCCTAATAGTTAGG - Intergenic
1101620494 12:106382348-106382370 TACAAGAGACCCTAATAGTTAGG - Intronic
1105778553 13:23685935-23685957 TACAAGAGACCCTAATGGTTGGG + Intergenic
1106334279 13:28768388-28768410 TACAAGAGACCCTAACAGTTAGG - Intergenic
1107311773 13:39086272-39086294 TACAAGAGACCCTAATAGTTAGG + Intergenic
1108778287 13:53794820-53794842 CAAAAAAGCCCGGAATAGCTGGG + Intergenic
1108963889 13:56272335-56272357 TACAAGAGACCCTAATAGTTAGG + Intergenic
1109141301 13:58716050-58716072 CACAAAAGCCCCTTATGGATAGG - Intergenic
1109606537 13:64705037-64705059 TACAAGAGACCCTAATAGGCAGG - Intergenic
1112680709 13:101761911-101761933 CACAAGAGTCCCTAAGAGAGAGG + Intronic
1113756798 13:112817990-112818012 CACAAGAGCCCCTGAGAGATAGG - Intronic
1113845810 13:113390633-113390655 CACAAGGGACCCTAATAGTTAGG + Intergenic
1118118603 14:62810249-62810271 CACAAGAGACCCTAATAGTTAGG + Intronic
1118592380 14:67411331-67411353 CTCCAGAGCCAGTAATAGCTGGG - Intronic
1118998042 14:70855317-70855339 CAAAAGAGACCCTAATAGTTAGG + Intergenic
1119804553 14:77474471-77474493 CACAAGAGCCACCAAAAGTTAGG - Exonic
1120895234 14:89524944-89524966 AACAAGAGACCCTCATAGTTAGG + Intronic
1121004061 14:90476605-90476627 TACAAGCGACCCTAATAGTTAGG + Intergenic
1121462241 14:94089840-94089862 TACAAGAGACCCTAATAGTTAGG - Intronic
1122173924 14:99902036-99902058 TACAAGAGACCCTAATAGTTAGG - Intronic
1122591687 14:102856827-102856849 TACAAGAGACCCTCATAGTTAGG - Intronic
1122677521 14:103428139-103428161 TACAAGAGACCCTAATAGGCAGG - Intronic
1126624157 15:50670120-50670142 CACAAGAGACCTTAATAGTTAGG + Intronic
1126690443 15:51285176-51285198 TACAAGAGACCCTAATAGTTAGG + Intronic
1127372284 15:58352658-58352680 TACAAGAGACCCTAACAGTTAGG - Intronic
1127768697 15:62212737-62212759 TACAAGAGACCCTAATAGTTAGG - Intergenic
1129531451 15:76268599-76268621 TACAAGAGACCCTAACAGGTAGG + Intronic
1130804466 15:87304312-87304334 CACAAAAGCCCCTAGCAGCAGGG - Intergenic
1135224920 16:20647399-20647421 TACAAGAGACCCTAATAGTTAGG + Intronic
1135930862 16:26735430-26735452 CAGATGAGTCCCAAATAGCTAGG - Intergenic
1136607756 16:31348116-31348138 CACAAGTGCCCCCAATCTCTGGG + Intergenic
1139204842 16:65017402-65017424 TAAAAGAGACCCTAATAGTTAGG - Intronic
1139736890 16:68997908-68997930 TACAAGAGACCCTAATAATTAGG - Intronic
1142767750 17:2075205-2075227 CACAACAGCCCCCCCTAGCTGGG + Intronic
1144158315 17:12530461-12530483 CACATGAGCCCTTAAAAGCAGGG - Intergenic
1148216363 17:45835896-45835918 CACAGCAGCCCCTGAAAGCTGGG - Intergenic
1149212056 17:54315145-54315167 TACAAGAGACCCTCATAGTTAGG - Intergenic
1155066724 18:22274548-22274570 CACATGGGCCCCTAAAGGCTTGG - Intergenic
1157573668 18:48730189-48730211 CACAGGAGCCCCTCACACCTCGG - Intronic
1157792404 18:50544467-50544489 TACAAGAGACCCTAATAGTTAGG + Intergenic
1157937927 18:51893636-51893658 TACAAGAGACCCTAATAGGCAGG - Intergenic
1158873954 18:61714925-61714947 TGCAAGAGACCCTAATAGTTAGG + Intergenic
1158990588 18:62864426-62864448 TACAAGAGGCCCTCATAGTTAGG - Intronic
1163962598 19:20711288-20711310 TACAAGAGTCCCTAATAGTTAGG - Intronic
1166401909 19:42487818-42487840 TACAAGAGACCCTAATAGGCAGG - Intergenic
1166519070 19:43467544-43467566 AAAAACAGCCCCTAACAGCTGGG + Intergenic
1166636576 19:44456680-44456702 CAGAAGAGCCCCTGAGGGCTGGG + Intergenic
1166900691 19:46059393-46059415 TACAAGAGACCCTAACAGTTAGG - Intronic
1167754017 19:51399653-51399675 TACAAGAGACCCTAATAGTTAGG - Intergenic
926564568 2:14455139-14455161 AGCCAGAGCCCCTAATATCTTGG - Intergenic
929637739 2:43542821-43542843 CACAACAGCACCTAATAGGCTGG + Intronic
930150231 2:48051698-48051720 CACAAAAGACTCTAATAGTTAGG - Intergenic
931455969 2:62410022-62410044 CACAAGAGCCCCTCCTACCCTGG - Intergenic
932069709 2:68607083-68607105 TACAACAGACCCTAATAGGTAGG - Intronic
933614673 2:84471495-84471517 TACAAGAGACCCTAATAGTTAGG - Intergenic
935728712 2:106046874-106046896 CACTTCAGCCCCTAGTAGCTGGG - Intergenic
935886080 2:107621128-107621150 TACAAGAGACCCTAATAGTTAGG + Intergenic
939843553 2:147217202-147217224 TACAAGAGATCCTAATAGTTAGG - Intergenic
939984103 2:148813577-148813599 CACAAGAGCCCCTAGTAACTTGG - Intergenic
940037295 2:149324204-149324226 TACAAGAGACCCTAATAGGTAGG + Intergenic
940430413 2:153583792-153583814 CACAAGTTTCCCTAACAGCTAGG - Intergenic
942194275 2:173502286-173502308 TACAAGAGACCCTAATAGTTAGG + Intergenic
942816692 2:180060793-180060815 TACAAGAGACCCTAATAGTTAGG + Intergenic
943466887 2:188239602-188239624 AATAAGAGACCCTAATAGTTAGG + Intergenic
944519751 2:200553056-200553078 TACAAGAGACCCTAACAGTTAGG - Intronic
946923939 2:224607416-224607438 CAGAGGAACCCCAAATAGCTCGG - Intergenic
947929610 2:233952757-233952779 CACAGGAGTCCCTCCTAGCTGGG - Intronic
1171079249 20:22161663-22161685 CCCAAGAGGCCCTCAGAGCTAGG - Intergenic
1171101877 20:22391469-22391491 CTCATGAGCTCCTAATATCTGGG - Intergenic
1173125157 20:40329946-40329968 GACAAGAGGCCCTCATCGCTTGG + Intergenic
1173481564 20:43404503-43404525 CACAAGAACCTCTCTTAGCTGGG + Intergenic
1178202055 21:30418586-30418608 CACAAGAGACCCTAATGGTTAGG + Intronic
1181812858 22:25414726-25414748 TACAAGAGACCCTAATAGGTAGG + Intergenic
1182491621 22:30676075-30676097 TACAAGAGACCCTAATAGGTAGG - Intergenic
1183270666 22:36860787-36860809 CACAAGACACCCTGATGGCTGGG + Intergenic
1183325539 22:37189591-37189613 CCCAAGAGACTCTAATAGTTAGG - Intronic
951731239 3:25812677-25812699 CACAAGAGCCCTTGATGACTAGG - Intergenic
952867432 3:37863205-37863227 CACAAGTGCCCTTTAAAGCTGGG - Intronic
953364691 3:42333771-42333793 AACAAGAGCAAATAATAGCTAGG - Intergenic
954024534 3:47771964-47771986 CTCAAGACTCCCGAATAGCTAGG - Intronic
954484332 3:50832805-50832827 TACAAGAGACCCTGATAGTTAGG - Intronic
956113457 3:65894812-65894834 CAGAAGAGACACTCATAGCTGGG - Intronic
957024684 3:75167936-75167958 CACTATAGCCCCAAATAGCTGGG - Intergenic
959228380 3:103616058-103616080 CACAAAAGCCCCTCATGACTGGG + Intergenic
959872697 3:111346578-111346600 TACAAGAGACCCTAACAGTTAGG - Intronic
960387029 3:117033282-117033304 CACAAGAGACCCTGATAGTTAGG + Intronic
960515031 3:118594287-118594309 CACAAGAGACCCTCACAGTTAGG + Intergenic
961007906 3:123417183-123417205 CTCAAGAGCCCCTGATTTCTTGG + Intronic
961725181 3:128923467-128923489 TACAAGAGACCCTAATAGGCAGG + Intronic
962581111 3:136798833-136798855 CCCCAGCCCCCCTAATAGCTGGG + Intergenic
966721571 3:183068001-183068023 CACAAGAGATCCTAATAGTTAGG + Intronic
966778424 3:183562939-183562961 CACCAGACCCCTTAATAACTTGG - Intergenic
969258839 4:6021285-6021307 AACAACAGCCCCTGAGAGCTGGG + Intergenic
971006653 4:22382056-22382078 CACAAGAGACCCTAATAGTTAGG + Intronic
972884763 4:43471822-43471844 TACAAGAGATCCTAATAGGTAGG + Intergenic
974332622 4:60499610-60499632 GACAATAGCCCCTAGAAGCTAGG - Intergenic
974922949 4:68264907-68264929 TACAAGAGACCTTAATAGTTAGG + Intergenic
975043491 4:69773390-69773412 CACAAGAGACCCTCATGGTTAGG + Intronic
975528299 4:75375087-75375109 TACAAGAGACCCTAATAGTTAGG + Intergenic
976643992 4:87368411-87368433 CACAAGAGACCCTAACAGTTAGG + Intronic
976647739 4:87402821-87402843 TACAAGAGACCCTAATAGTTAGG - Intergenic
977623720 4:99166395-99166417 TACAAGAGATCCTAATAGTTAGG - Intergenic
979773822 4:124562665-124562687 CACTAGAGACACTAATAGTTAGG + Intergenic
980563780 4:134510977-134510999 AACAAGAACCCCAAATGGCTAGG + Intergenic
982864492 4:160493133-160493155 TACAAGAGACCCTAATAGTTAGG + Intergenic
983803218 4:171962096-171962118 TACAAGACACCCTAATAGTTAGG + Intronic
984096813 4:175444893-175444915 TGCAAGAGACCCTAATAGTTAGG - Intergenic
984938391 4:184909793-184909815 TACAAGAGACCCTAATAGTTGGG - Intergenic
986141508 5:5034720-5034742 CACATCAGCCCCTAGTAGCTGGG - Intergenic
986542602 5:8862856-8862878 CTCAAGCTCCCCAAATAGCTGGG - Intergenic
987876802 5:23690407-23690429 TACAAGAGACCCTAACAGTTAGG + Intergenic
987923081 5:24308708-24308730 TACAAGAGACCCTAATAGGTAGG - Intergenic
987956502 5:24748288-24748310 TATAAGAGACCCTAATAGTTAGG - Intergenic
988456875 5:31394586-31394608 TATAAGAGACCCTAATAGTTAGG - Intergenic
991037626 5:62144006-62144028 CTCCAGAGCTCCTAAAAGCTGGG - Intergenic
991149303 5:63347642-63347664 CATAAGACTCCCAAATAGCTGGG + Intergenic
992643589 5:78791854-78791876 GAAAAAAGCCCCTAACAGCTGGG + Intronic
993485309 5:88476620-88476642 CAAAGGAGCCCTTATTAGCTTGG + Intergenic
993980985 5:94543591-94543613 CACAGGAGACCCTAATAGTTAGG + Intronic
995195307 5:109360313-109360335 CTCAAGAGTACCTGATAGCTTGG - Intronic
995209840 5:109525091-109525113 GACCAGAGGCCCTAAAAGCTGGG - Intergenic
996057277 5:118995216-118995238 TACAAGAGACCCTAGTAGTTAGG - Intergenic
998275125 5:140745034-140745056 TACAAGAGACCCTAATAATTAGG - Intergenic
1000415891 5:160983546-160983568 CACAAGAGACCCTAATAGCTAGG + Intergenic
1004243282 6:13947638-13947660 CCCAGGAGCCCCAAATATCTTGG - Intronic
1004796766 6:19095101-19095123 CACAGGAGCCCCTTAAATCTGGG - Intergenic
1005921586 6:30406600-30406622 TACAAGAGACCCTAATAGTTAGG + Intergenic
1007523530 6:42470843-42470865 TACAAGAGACCCTAATAGTTAGG + Intergenic
1010686256 6:78857993-78858015 TACAAGAGAGCCTAATAGTTAGG + Intergenic
1012383005 6:98642496-98642518 CACAAAAGCAACTAATGGCTAGG + Intergenic
1013247586 6:108301481-108301503 TACAAGAGACCCTAATAGTTAGG - Intronic
1013523441 6:110953694-110953716 TACAAGAGCCCCTCATAGTTAGG + Intergenic
1015270363 6:131332147-131332169 TACAACAGACCCTAATAGTTAGG + Intergenic
1015568848 6:134601442-134601464 TACAAGAGACCCCAATAGGTAGG - Intergenic
1017404540 6:154104141-154104163 CACAAGAGCCCCTAATAGCTAGG - Intronic
1018357300 6:163031029-163031051 CACAAGAGACCCTAGAAGTTAGG - Intronic
1020347364 7:7180819-7180841 CACAACAGCCTCGAATAACTGGG - Intronic
1021676116 7:23082277-23082299 TGCAAGAGACCCTAATAGTTAGG - Intergenic
1024526537 7:50354322-50354344 CACCAGAGCCCCCACTAGCCAGG + Intronic
1025769156 7:64488095-64488117 TGCAAGAGACCCTCATAGCTAGG + Intergenic
1028388853 7:90291703-90291725 CACAAGAGACCCTAATAGATAGG - Intronic
1029559863 7:101295431-101295453 CTCCAGAGTCCCAAATAGCTGGG + Intergenic
1030155993 7:106456145-106456167 TATAAGAGACCCTAATAGTTAGG - Intergenic
1030189612 7:106797054-106797076 TACAAGAGACCCTAATAGTTAGG - Intergenic
1030583913 7:111392967-111392989 CACAAAAACCCCTAAATGCTTGG - Intronic
1031154550 7:118094634-118094656 CCCAAGAGCCCCTAATGACCAGG - Intergenic
1031720345 7:125167712-125167734 CACAAGAGCTCCTCATAGATTGG - Intergenic
1032226442 7:130035595-130035617 CTCAACATCCCCTAGTAGCTGGG + Intronic
1032671547 7:134087301-134087323 TACAAGAGACTCTAATAGTTAGG - Intergenic
1032896879 7:136261267-136261289 TACAGGAGACCCTAATAGTTAGG - Intergenic
1033086308 7:138345202-138345224 TACAAGAGACCCTAATAGGTAGG + Intergenic
1033161931 7:139005612-139005634 TACAAGAGACCATAATAGTTAGG + Intergenic
1033578312 7:142708293-142708315 CACAAGAGACCATAATAGTCAGG + Intergenic
1036196541 8:6721678-6721700 CATAAGAGCCACTAAGAGGTAGG - Intronic
1036565008 8:9931056-9931078 GATAAGAGCCCCTAATACCATGG + Intergenic
1039115985 8:34091773-34091795 TGCAAGAGACCCTAATAGTTAGG + Intergenic
1040516216 8:48137164-48137186 CACAGGAGCCCGTAACAGCAGGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1044140893 8:88650969-88650991 CATTAGAGCCCTTAATAACTTGG + Intergenic
1044378216 8:91501155-91501177 TACAAGAAACCCTAATAGTTAGG - Intergenic
1045428554 8:102091816-102091838 CACAAGAGACCCTAATAGTTAGG + Intronic
1047079439 8:121443359-121443381 CACAAGATCCCAGAATAGATAGG - Intergenic
1050870024 9:10555485-10555507 CCCAAGTGCTCCTAATAGCTTGG - Intronic
1051772522 9:20594362-20594384 TACAAGAGACCCTAATAGGCAGG + Intronic
1051871981 9:21748470-21748492 CACAATAGCCCCTTAGAGCAAGG - Intergenic
1052416766 9:28187890-28187912 CCTCAGAGCCCCTAATAACTAGG + Intronic
1052528793 9:29655808-29655830 TACAAGAGACCCTAATAGTTAGG - Intergenic
1052538319 9:29776220-29776242 TACAAGAGACCCTAATAGTTAGG - Intergenic
1052845960 9:33336714-33336736 CACAAGCCTCCCAAATAGCTGGG + Intronic
1057046751 9:91892138-91892160 CACAGGAGCCCTTAAAATCTGGG - Intronic
1058016085 9:100033864-100033886 TACAAGAGACTCTAATAGGTAGG + Intronic
1058355379 9:104077955-104077977 TACAAGAGACCCTAATAGGCAGG - Intergenic
1059314433 9:113411790-113411812 CACCTCAGCCCCAAATAGCTGGG + Intronic
1060936699 9:127520126-127520148 CACTTCAGCCCCTAACAGCTAGG - Intronic
1060997119 9:127880860-127880882 CTCAAGACCCCCCAGTAGCTGGG + Intergenic
1203698580 Un_GL000214v1:117771-117793 CAAAAGAGCCCCTGAGGGCTGGG + Intergenic
1188126294 X:26373483-26373505 TACAAGAGACCCTAATAGTTAGG - Intergenic
1188133719 X:26469024-26469046 TACAAGAGACCCTCATAGTTAGG - Intergenic
1188626287 X:32289263-32289285 TACAAGAGACCCTAATAGTTAGG + Intronic
1189086200 X:38027050-38027072 TACAAGAGACCCTAATAGTTAGG - Intronic
1190244204 X:48680195-48680217 TACAAGAGACCCTAATAGGCAGG + Intronic
1190920342 X:54845470-54845492 CACAAGAGACCCTAATAGGCAGG - Intergenic
1190947560 X:55110753-55110775 CACAAGAGACCCTAATAGTTAGG + Intronic
1191004876 X:55700649-55700671 CACAAGAGACCCTAATATTCAGG - Intergenic
1193883205 X:86952040-86952062 TACAAGAGACTCTAATAGTTAGG - Intergenic
1194033428 X:88842922-88842944 TAAAAGAGACCCTAATAGTTAGG - Intergenic
1194085912 X:89528429-89528451 TACAAGAGACCCTAATAGCTAGG - Intergenic
1194206141 X:91014217-91014239 CACCAGAAACCCTAATAGCCAGG - Intergenic
1195059878 X:101183897-101183919 TACAATAGACCCTAATAGGTAGG - Intergenic
1195650590 X:107279087-107279109 TACAAGAGACCCTAAGAGTTAGG - Intergenic
1196105853 X:111894525-111894547 GGCAAGAGACCCTGATAGCTAGG - Intronic
1196373005 X:114999901-114999923 TACAAGAGATCCTAATAGTTAGG + Intergenic
1196663556 X:118293712-118293734 TACAAGAGAACCTAATAGGTAGG - Intergenic
1197421402 X:126239733-126239755 CACAACAGCCAATAATAGATGGG + Intergenic
1197626295 X:128805810-128805832 CACAAGAGACCCTGATATTTTGG + Intergenic
1197738908 X:129874289-129874311 TACAAGAGACCCTAATAGGTAGG + Intergenic
1198344534 X:135746731-135746753 TACAAGAGACCCTAACAGTTAGG + Intergenic
1198844523 X:140895992-140896014 TACAAGAGACCCTAATAGTTAGG - Intergenic
1198847047 X:140923448-140923470 TACAAGAGACCCTAATAGTTAGG - Intergenic
1199058341 X:143324863-143324885 AACAAAAGTCCCTGATAGCTTGG + Intergenic
1200438564 Y:3184296-3184318 TACAAGAGACCCCAATAGCTAGG - Intergenic
1200551897 Y:4589033-4589055 CACCAGAAACCCTAATAGCCAGG - Intergenic
1200738540 Y:6827989-6828011 AATAAAAGCCCCTAATAGTTTGG - Intergenic
1201279278 Y:12327107-12327129 TACAAGAGACCCTAATAGGCAGG + Intergenic
1201570095 Y:15404349-15404371 TACAAGAGGCACTAATAGGTAGG + Intergenic