ID: 1017405642

View in Genome Browser
Species Human (GRCh38)
Location 6:154115727-154115749
Sequence TCTGCCCTGGGGCAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017405642 Original CRISPR TCTGCCCTGGGGCAGCAACC TGG Intronic
900229841 1:1551052-1551074 GCTGGCCTGGGGAAGCAGCCAGG - Intronic
900245473 1:1634253-1634275 CCTGCCCTCGGGCACCAGCCTGG - Exonic
900256704 1:1701412-1701434 CCTGCCCTCGGGCACCAGCCTGG - Intronic
900286146 1:1901581-1901603 TCTTCCCAGGGGCGGCACCCCGG + Intergenic
901069301 1:6509280-6509302 CCTGGCCTGGGGCTGGAACCAGG + Intronic
901756444 1:11444283-11444305 GCTTCCCTGGGGTAGGAACCAGG + Intergenic
901923849 1:12553656-12553678 GCTGCCCTGGGGCAGGGACAGGG - Intergenic
902372435 1:16014969-16014991 TCTGCCCTGGCACAGCCAGCTGG + Exonic
902565389 1:17308047-17308069 TCTGCCCTGGGGCTGCCCCTCGG - Intergenic
903801691 1:25973567-25973589 TCTGACCTGGGGAAGCATTCAGG + Intronic
903859088 1:26354397-26354419 TCTGCCCTGGGGAAGGATGCAGG + Intergenic
903971123 1:27119418-27119440 ACTGCTCTGGGGCTGCAACTCGG + Intronic
905022605 1:34828193-34828215 GGTGCCCTGGGGCAGGAAGCAGG - Intronic
906654837 1:47540544-47540566 GTTGGCCTGGGGCAGCAGCCAGG + Intergenic
910125605 1:83838442-83838464 ACAGCACTGGGGCAGCATCCTGG + Intergenic
911051792 1:93677577-93677599 TCTGACCTGGGGCAGCAGCTGGG + Intronic
915467910 1:156108164-156108186 GCTGCCATGTGCCAGCAACCAGG - Intronic
915632525 1:157163395-157163417 CCTCCACTGGGGCAGAAACCTGG + Intergenic
921670418 1:217918401-217918423 TCTAGTCTGGGGCAGTAACCTGG + Intergenic
922571404 1:226636512-226636534 TCAGCCCTGAGGCAGCCAGCAGG - Intronic
922573131 1:226645414-226645436 GCAGCCCTGGGGCAGGAAGCGGG + Intronic
924739145 1:246784743-246784765 TCCTCCCTGGGGCAGCATCTTGG + Intergenic
1063154363 10:3364973-3364995 TGAGCCGTGGGGCTGCAACCTGG + Intergenic
1065189844 10:23199059-23199081 GCTGCCCTGGGGATGCAGCCAGG - Intergenic
1065506940 10:26438738-26438760 TCCTCCCCGGGGCAGCGACCTGG + Exonic
1066535003 10:36381751-36381773 TCTGCCCAGGGGAAGGAAACTGG - Intergenic
1067069021 10:43119194-43119216 CCTGCACTGGGGCAGGACCCAGG + Intronic
1067286686 10:44912310-44912332 CCTGCCCTGGGGAAGCGAGCAGG - Intronic
1069204799 10:65668128-65668150 TTTCCACTGGGGCAGAAACCTGG - Intergenic
1069246593 10:66214831-66214853 TCTACCCTCAGGCAGCCACCTGG - Intronic
1069635753 10:69923822-69923844 GCTGCCCTGGGGGGCCAACCTGG - Exonic
1069876744 10:71567765-71567787 TATGCCCTGAGGCAGCAGCTGGG - Intronic
1070322378 10:75363944-75363966 CCTGCCATGGAGCAGCATCCTGG - Intergenic
1070835852 10:79446443-79446465 TCTTTCCTGGGGCAGGAACCCGG - Intergenic
1074012312 10:109494921-109494943 TCTGCTCTGGAGCAGAATCCTGG + Intergenic
1075489704 10:122856225-122856247 TCAGCACAGGGGCAGCACCCAGG + Intronic
1075674909 10:124289680-124289702 TCAGCCCTGGGGCACCGAGCTGG + Intergenic
1075810097 10:125218914-125218936 CCTGGCCTTGGGCAGCACCCAGG + Intergenic
1076385488 10:130052204-130052226 TTTGCCCTGGGTTAGGAACCTGG + Intergenic
1076667189 10:132100065-132100087 TCAGCCCGGGGGCAGGAGCCAGG - Intergenic
1076705265 10:132297968-132297990 GGTGCTCTGCGGCAGCAACCCGG + Intronic
1077159907 11:1107945-1107967 ACTGCCCCGGGGCGGCCACCTGG - Intergenic
1077489603 11:2854658-2854680 GGTGCCCTGGGGCAGGAGCCAGG + Intergenic
1077907594 11:6546187-6546209 TCTGCCCTGGGCCAGCGCCTGGG + Exonic
1078761643 11:14256373-14256395 TCTGCCATGGGCCAGGAACTGGG + Intronic
1079150507 11:17894926-17894948 TCTGCCCTGTGGCATCACCCAGG - Intronic
1081709265 11:45206441-45206463 CCTGCCCTGTGGCTGCAGCCTGG + Intronic
1081786353 11:45750531-45750553 TCTGCCCTGGGGCAGCAGCATGG + Intergenic
1081989952 11:47332423-47332445 CCTGCCCAGGGGGAGGAACCCGG + Intronic
1082011120 11:47450034-47450056 TTTGCCCTGGGGCAGGAAGAAGG - Intergenic
1082028211 11:47587734-47587756 GCTGCCCTGGGGCAGCAGAGAGG - Exonic
1083591738 11:63899437-63899459 TCTTCCCTGGGTCAGCTACCAGG - Intronic
1085040629 11:73324384-73324406 CCTGCCCTGGGGGAGCGCCCAGG + Intronic
1085324365 11:75595305-75595327 ACTGTCCTGGGGCAGCCAGCAGG - Intronic
1085524391 11:77155813-77155835 TCTGCCCTGCTCCAGCACCCTGG - Intronic
1088878761 11:113957472-113957494 GCTGCCCTGGGCCAGCCTCCGGG + Intergenic
1089817560 11:121189892-121189914 TCTACCCTGGGGCAGGCAGCTGG + Intronic
1090359633 11:126163456-126163478 TGTGCCCTGGGGCCCCAGCCTGG - Intergenic
1090522991 11:127498609-127498631 TTTGCCCAGGGTCACCAACCAGG - Intergenic
1090630543 11:128643716-128643738 TCGGCCCTGGGGCAGCCTACTGG + Intergenic
1090898424 11:131002375-131002397 TCAGCCTTGGGACAGCAATCGGG - Intergenic
1091121912 11:133064350-133064372 TCTGCCCGGGGGCCTCAGCCGGG - Intronic
1091281596 11:134384642-134384664 GCAGCACTGCGGCAGCAACCAGG + Intronic
1092603132 12:10089089-10089111 TCTGACCTGGGGGAGGATCCTGG - Intronic
1092757091 12:11773956-11773978 TCTTCTCTGTGGCAGCACCCAGG - Intronic
1092915163 12:13182939-13182961 TCTGACCTGGGGCACCAAGGTGG + Intergenic
1092978965 12:13774432-13774454 TCATCCCTGGGACAGCAACTAGG + Intronic
1097052249 12:56230566-56230588 TCTGCCCTGGGAAAGCCACATGG - Intronic
1100409390 12:94299947-94299969 TCTGAGCAGGGGCAGCAGCCAGG + Intronic
1102747241 12:115259882-115259904 AGTGCCCTGGGGCAGCATCCAGG - Intergenic
1103587787 12:121968964-121968986 TCTGCCCTGCGGCAGCATGCCGG - Intronic
1104198443 12:126564337-126564359 GCTTCCCTGGGCCAGTAACCTGG + Intergenic
1104285198 12:127418553-127418575 CAGGCCCTGGGGCAGCACCCAGG - Intergenic
1104367780 12:128193342-128193364 CCTGCCCTGGGGAACCAACATGG + Intergenic
1104787886 12:131461494-131461516 TCTTCCCTGGGGCTGCCCCCTGG - Intergenic
1105296322 13:19090448-19090470 CCTGCCCTGTGCCAGCAGCCTGG + Intergenic
1112074384 13:95894077-95894099 GCTGGCCTGAGGCAGCAGCCGGG + Intronic
1112439222 13:99413863-99413885 CCTGCCCTGGGAAAGCAGCCAGG + Intergenic
1113927172 13:113947978-113948000 TGGGCGCTGGGGCAGCACCCTGG - Intergenic
1114463051 14:22900452-22900474 TCTGTCCTGGTGCTGCAACTTGG + Intergenic
1119443877 14:74647857-74647879 ACTGGCCTTGGGCAGCAGCCAGG - Intergenic
1121580483 14:95026079-95026101 TCTGCCCTGGGGAACCACTCTGG - Intergenic
1121866445 14:97366755-97366777 TCTGCCCTGGGAGAGCTATCAGG - Intergenic
1121979773 14:98444478-98444500 ACAGCCCTGGGCAAGCAACCTGG - Intergenic
1122599126 14:102912561-102912583 TGTGTCCTGGGGCAGCTCCCGGG - Intergenic
1122776024 14:104117267-104117289 CCTGCCCTGCTGCAGCCACCCGG - Intergenic
1124372645 15:29112138-29112160 GCTGGCCTGGGGCAGCCACTCGG + Intronic
1125593544 15:40870586-40870608 TCCCCTCTGGGGCAGAAACCTGG - Intergenic
1126877530 15:53060405-53060427 TCAGAACTGTGGCAGCAACCAGG - Intergenic
1127835333 15:62786365-62786387 TCTGCCCTGGAACATCAAGCAGG + Intronic
1129232707 15:74205680-74205702 TCTGCCCAGGGGCTGCAGCCAGG + Intronic
1130062546 15:80580311-80580333 TCTGCCCTGGGCCATCTTCCTGG - Intronic
1130885704 15:88090771-88090793 TCTGCCCAGGGGCCGAACCCTGG + Intronic
1130980396 15:88808272-88808294 CCTGCTCTGGGGCAGCAGCCTGG - Intronic
1130992938 15:88887323-88887345 TTTGCCCTGGGGCCCCAGCCTGG - Exonic
1131577518 15:93606457-93606479 TCTGCCCTGAGGTACCCACCTGG - Intergenic
1131830641 15:96352609-96352631 CCTGCCCTGGCCCAGCCACCCGG + Intergenic
1132712699 16:1276563-1276585 CCTGCCCTCGGGCAGGAGCCGGG + Intergenic
1133087527 16:3376396-3376418 TCTCCCTTGGGGCAGTGACCAGG + Intronic
1133444111 16:5845549-5845571 CCTGCCCCGGGTCATCAACCTGG - Intergenic
1137802492 16:51274167-51274189 TCCACACTGGAGCAGCAACCTGG - Intergenic
1140437443 16:74959103-74959125 TCTCCACTGAGGCAGCCACCTGG - Intronic
1141414016 16:83856039-83856061 TCATCCCTGGGGCAGCAGCCTGG - Intergenic
1141698781 16:85632981-85633003 TGAGCCCAGGGGCAGCCACCTGG - Intronic
1141879273 16:86847120-86847142 TCAGGCCTGGGGCTGCTACCTGG - Intergenic
1141909398 16:87048164-87048186 CCTGCCCCGGGGCAGCCCCCCGG + Intergenic
1142039810 16:87885746-87885768 TCTGCCCTTGGGTAGCCACGTGG + Exonic
1142187143 16:88699945-88699967 TCTGGCCGAGGGCAGAAACCTGG + Intronic
1142273977 16:89106036-89106058 TCTGCCCAGGGGCATCTGCCAGG + Intronic
1142439962 16:90091298-90091320 TCTTTCCTGGGGCAGCCTCCAGG - Intronic
1142753786 17:2003620-2003642 TCTGCCCAGGGTCAGGCACCTGG + Intronic
1142940755 17:3378389-3378411 TCTGCCCTGGAGCAGGTGCCAGG + Intergenic
1143867577 17:9935154-9935176 TCTGCCCTGTGGCTGCATCTAGG - Intronic
1144819055 17:18058662-18058684 TCAACCCTGGGGCAGATACCTGG - Intronic
1144952079 17:18999879-18999901 CCTGCCCTGGGGCCTCACCCTGG + Intronic
1146500938 17:33363875-33363897 CCTTTCCTGGGGCAGCCACCTGG + Intronic
1146789988 17:35745708-35745730 TCTGCCCTTGGGCGGGAACAAGG - Exonic
1147924881 17:43940154-43940176 TCCTCCCTGGGGCAGGATCCAGG + Intergenic
1148163916 17:45469023-45469045 TCTGCCCTGGGGCAGGGACTAGG + Intronic
1148868612 17:50642445-50642467 CCTGCTCTGTGGCAACAACCAGG - Intronic
1149102901 17:52927770-52927792 CCAGCCCTGTGGCAGCATCCAGG + Intergenic
1149496759 17:57123308-57123330 CCTGGCCTGGGGTAGCAGCCTGG - Intergenic
1150395146 17:64815677-64815699 TGTGCCCTGGGGCAGGGACTAGG + Intergenic
1151352641 17:73540893-73540915 TCTTCCCTGGGGCAGGAGCTGGG + Intronic
1151804263 17:76396004-76396026 TTTGCCCTGGGGCAGTAGCTGGG + Intronic
1152541758 17:80980125-80980147 TCTCCCCAGGGGGAGCAGCCAGG + Intergenic
1152657884 17:81528357-81528379 TCTGACCCGCGGCAGCAGCCTGG - Intergenic
1152957593 18:52256-52278 TCTTTCCTGGGGCAGCCTCCAGG + Intronic
1153647264 18:7206346-7206368 TCTGCCCCGAAGCAGCAGCCAGG - Intergenic
1154499977 18:14991318-14991340 GCTGCCCTGGGGCAGAACACTGG + Intergenic
1156025140 18:32645066-32645088 TCTTCCCTGAGGCAGAAATCAGG + Intergenic
1156814713 18:41295978-41296000 AGTGCCCAGGGGCAGCAAACGGG + Intergenic
1157785757 18:50481205-50481227 TCTGCCATTGGTCAGCCACCTGG - Intergenic
1160160548 18:76466923-76466945 GATGCCCTGGGGCAGGACCCTGG + Intronic
1161138137 19:2632896-2632918 TCTGCACTGGGGCACCCGCCTGG + Intronic
1161318887 19:3632030-3632052 ACTGCCCTGGGGCAGCTTCCTGG - Exonic
1161395402 19:4042721-4042743 CCTGGCATGGGGCAGCACCCTGG + Intergenic
1161504072 19:4634629-4634651 TCTGCCTTGTGGCAGAAGCCAGG - Intergenic
1162823161 19:13235579-13235601 TCAGCCCTGGGCCAGCAGCAGGG + Intronic
1164685682 19:30165196-30165218 TCTGCCCAGGGACAGCCACGAGG - Intergenic
1165136824 19:33674796-33674818 CCTGACCTTGGGCAGCAACTAGG + Intronic
1166744868 19:45136817-45136839 TCTGCTCTGGACCAGCCACCTGG + Intronic
1166930311 19:46298028-46298050 TGTGCCCTGGGGCCGCTGCCGGG + Intronic
1167761016 19:51449323-51449345 TGTGCCTTGGGGCAGCTGCCTGG + Intergenic
925317779 2:2938730-2938752 ACTGCCCTGGAGCAGCCAGCAGG - Intergenic
925339611 2:3127062-3127084 GCAGCCCTGAGGCAGCAGCCGGG + Intergenic
926250588 2:11153497-11153519 ACTGCCATGTGGCAGGAACCAGG + Intergenic
927497526 2:23560948-23560970 TCAGCCCTGGGGAGGCACCCTGG - Intronic
928073545 2:28241916-28241938 TCTTCCCTAGAGCAGCAGCCTGG + Intronic
929138645 2:38648282-38648304 ACTGTCCTGATGCAGCAACCTGG + Intergenic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
930582416 2:53228296-53228318 TGCTCCCTGGGGAAGCAACCAGG - Intergenic
932399487 2:71470093-71470115 TCTGCCCTGTGTCATCAGCCAGG + Intronic
932492632 2:72131765-72131787 TCTGCCCAGGAACAGCATCCTGG - Exonic
935094405 2:99930602-99930624 TCTGCACTGGGGGACAAACCAGG + Intronic
935128065 2:100241365-100241387 TCACCACTGGGGCAGGAACCAGG + Intergenic
935677600 2:105609406-105609428 TCTGCCGTGGGGCAGGGTCCTGG - Intergenic
936048891 2:109208169-109208191 ACTGCCCTGTGGCACCTACCTGG + Intronic
938011313 2:127831285-127831307 TCTGCCATGTGGCTGCAACATGG + Intergenic
938245023 2:129769655-129769677 TCTGCCCTGCGGCTGCTCCCAGG - Intergenic
938493291 2:131776976-131776998 GCTGCCCTGGGGCAGAACACTGG - Intergenic
938499191 2:131821677-131821699 GCTGCCCTGGGGCAGAACACTGG + Intergenic
938656762 2:133442596-133442618 TCAGCCCTGGGGCAATAGCCTGG - Intronic
939154032 2:138502485-138502507 TCTGCCTTTGGGCAGCACTCAGG - Intronic
939553954 2:143651304-143651326 TTTGCTCTGGGGCAGGGACCAGG - Intronic
940130003 2:150370187-150370209 TCTGGGCTGGGGCAGAAGCCGGG + Intergenic
940872180 2:158869227-158869249 AGTGCCCTGGGGCAGCGATCTGG - Intergenic
942568243 2:177288016-177288038 TCTGCACTTGGGCAGCCTCCAGG - Intronic
946740543 2:222796825-222796847 TCAGCTCTTGGGCAGCAGCCTGG - Intergenic
947463985 2:230325450-230325472 ACTGCTCTTGGGCAGCAAGCAGG - Intergenic
948413744 2:237785117-237785139 TTTTCCCTGGGGCAGCAGGCTGG - Intronic
948884080 2:240874369-240874391 TCTGCCCTGGCTCAGCTTCCAGG + Intronic
948901461 2:240958719-240958741 TCTGCCCTGCTGCCGCAACCTGG + Intronic
1168973149 20:1944801-1944823 CTTGCCCTGAGGCAGCAACTGGG - Intergenic
1169423167 20:5475574-5475596 TCTGCCATGGGTCAGCAGACAGG + Intergenic
1171776687 20:29374905-29374927 TCTTTCCTGGGGCAGCCTCCAGG + Intergenic
1171818084 20:29806382-29806404 TCTGTCCTGGGGCAGCCTCCAGG + Intergenic
1171900162 20:30848897-30848919 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1172647458 20:36479855-36479877 TCTGGCCTGGGGCAGAAATGAGG - Intronic
1173340728 20:42150408-42150430 TGTGCCCTGGAGCATCAGCCAGG - Intronic
1173432622 20:43003546-43003568 TCGGCCCTGAGCCAGCAACATGG + Intronic
1173517738 20:43677202-43677224 TCTGCTCTGGGGTAGGAACTTGG - Intronic
1173793019 20:45840507-45840529 TCACCCCTGGGACAGCACCCAGG - Intronic
1174501044 20:50984818-50984840 GCTGCTCTGGGGAAGCAAGCTGG - Intergenic
1175477940 20:59290141-59290163 ACTTCACTGGGGCAGCAGCCAGG + Intergenic
1175958006 20:62621254-62621276 GCTGCCCTGGGGTCGCAGCCTGG + Intergenic
1176097992 20:63353039-63353061 TGGGCCCTGGAGCAGGAACCTGG - Intronic
1176710602 21:10146462-10146484 GCTGCCCTGGGGCAGAACACTGG - Intergenic
1179810661 21:43866975-43866997 TCTGCACTGGGGCCCCAGCCTGG - Intronic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1180321526 22:11325866-11325888 TCTGTCCTTGGGCAGCCTCCAGG + Intergenic
1180333527 22:11554892-11554914 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1181303779 22:21902430-21902452 TATCCCCTGGGGCACCACCCAGG + Intergenic
1182112178 22:27731597-27731619 TCTGCCCAGGGTCAGTAGCCAGG - Intergenic
1182994908 22:34803130-34803152 TCTAACCTGGGTCAGGAACCAGG + Intergenic
1183492607 22:38124674-38124696 TCTGCCCTGGTGGAGCTTCCAGG - Intronic
1184391251 22:44204842-44204864 TTTGCCTTAGGGCAGCAGCCTGG - Intronic
1184511166 22:44934141-44934163 CCTGCCTTGTGGCAGCCACCAGG - Intronic
1185374916 22:50478080-50478102 TCTGCCCTCAGGCATCAGCCTGG - Intergenic
950467200 3:13162521-13162543 TCTGCCCTGAGGAAGCATACAGG + Intergenic
951639550 3:24821334-24821356 TCTGCATTGGGGCAGGAACATGG - Intergenic
952613468 3:35240287-35240309 TCTGAACTGGGGCAGCAGCAGGG + Intergenic
954808269 3:53232639-53232661 TCCGGCCTGGGGCAGAACCCAGG + Intronic
956125726 3:66009162-66009184 AATGTCCTGGGGCAGCCACCAGG - Intronic
957088397 3:75704744-75704766 TCTTTCCTGGGGCAGCCTCCAGG - Intergenic
958108961 3:89114653-89114675 TCCGCCCGGGGGCAGAAACCCGG - Intronic
958717238 3:97799925-97799947 TCTTACTTGGGACAGCAACCAGG + Intronic
960023094 3:112977475-112977497 TGTGCCCAAGGGCCGCAACCAGG - Intergenic
961666860 3:128497981-128498003 CCTGCGCTTGGGCAGCAGCCGGG - Intergenic
962403067 3:135078121-135078143 TCTACCCTTGAGCAGGAACCTGG - Intronic
966419793 3:179726260-179726282 CATGCCCTGGGGCAGCAAGAGGG + Intronic
967076591 3:186008851-186008873 TCTCCCCTGGGGCCTCACCCAGG + Intergenic
968086001 3:195874129-195874151 TCTGGCCCGCGGCAGCCACCGGG - Intronic
968124978 3:196152261-196152283 TCTGCCCTGGGGGAGGAGGCTGG + Intergenic
968357138 3:198117916-198117938 TCTTTCCTGGGGCAGCCTCCAGG - Intergenic
968657302 4:1784159-1784181 TGTGTCCTGGTGCAGCAAGCTGG + Intergenic
968731273 4:2270465-2270487 CCTGCCCTGAGGCAGCCACCAGG + Exonic
969656360 4:8501050-8501072 TCTGCCCTGGGCCAGAAACCCGG + Intergenic
970092975 4:12430612-12430634 TCTCCCTTGGGGGAGCAGCCAGG - Intergenic
970236057 4:13959191-13959213 TCTGCAGGAGGGCAGCAACCAGG - Intergenic
970273553 4:14372589-14372611 GTTGCCCTGGGGCACCACCCAGG + Intergenic
974479344 4:62423353-62423375 CCTGCCCTGAGGCAGTTACCAGG - Intergenic
974877402 4:67716125-67716147 CCAGCCCTGGGGCAGCAGTCGGG + Intergenic
976161202 4:82201393-82201415 TCTGCCCCAGGGTAGGAACCTGG + Intergenic
978404300 4:108363427-108363449 TGGTCCCGGGGGCAGCAACCGGG - Intergenic
982245430 4:153345373-153345395 CCTGCCCTTTGGCAGAAACCGGG - Intronic
984816197 4:183839081-183839103 TCTTCCCTGGGTCTCCAACCTGG - Intergenic
985442521 4:189993652-189993674 TCTTTCCTGGGGCAGCCTCCAGG + Intergenic
986739309 5:10692297-10692319 TCAGAACTGGGGCAGAAACCAGG - Intronic
987211268 5:15686018-15686040 TTTGCCATAGAGCAGCAACCAGG + Intronic
987885303 5:23805418-23805440 CCTTCCCTGGGGCAGTTACCAGG + Intergenic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
990162376 5:52956421-52956443 TCTCCCCTGGGGGAGAAAACTGG - Exonic
991012902 5:61902167-61902189 TCTGGCCTTGGGGAGCAGCCAGG - Intergenic
991955947 5:71996186-71996208 TCTGTCATGAGGCAGCAAACAGG - Intergenic
995833556 5:116378638-116378660 TCTGCTCGGGGGCAGCAAGCAGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002261214 5:177995213-177995235 CCTGCCCTGGCCCAGCCACCAGG + Intronic
1002660120 5:180786060-180786082 GCTGCCCTGGTTCAGCTACCAGG - Intergenic
1004189137 6:13448940-13448962 TCTGCCCTTGGAGAGCCACCTGG + Intronic
1006100130 6:31681383-31681405 TGTTCCCTGGGGAAGAAACCTGG + Intronic
1006294251 6:33162957-33162979 TCTTCCCTGGGGGAGCATCCTGG + Exonic
1006783611 6:36649891-36649913 TTTGCCCTCAGGCAGGAACCAGG - Intergenic
1007685810 6:43666721-43666743 TCTGACCTTGGGCTGCAGCCAGG + Intronic
1007814903 6:44514823-44514845 GCTGAACTGGAGCAGCAACCAGG + Intergenic
1012983054 6:105850235-105850257 TCTGCTCTGGGACAGCCATCAGG - Intergenic
1014255937 6:119160034-119160056 TGTGCCCAGTGGCAACAACCAGG + Intergenic
1015573681 6:134648312-134648334 TTTGCCCTGTGCCAGCAACTGGG - Intergenic
1016068661 6:139710774-139710796 TCTGCACTGTGGCAGCCACAGGG - Intergenic
1016617565 6:146070087-146070109 GCTTCCCAAGGGCAGCAACCAGG - Intronic
1017405642 6:154115727-154115749 TCTGCCCTGGGGCAGCAACCTGG + Intronic
1017484421 6:154889731-154889753 TCTGCCCTGGGGAGGCAGGCAGG + Intronic
1017939911 6:159042820-159042842 TCTGTCCTAAAGCAGCAACCTGG - Intronic
1018048013 6:159981692-159981714 TCAGCGCTGGGGCAGGAATCTGG + Intronic
1018277960 6:162153365-162153387 TAGGCCCTGTGGCAGCATCCAGG + Intronic
1019067081 6:169311187-169311209 TCTTCCGTGGGGCAGGGACCAGG + Intergenic
1019364882 7:628157-628179 GCACCCCTGGGGCAGCAAACAGG + Intronic
1020143463 7:5624917-5624939 TCTGTCCTGAGGCAGCAGCCCGG - Intronic
1022217818 7:28281619-28281641 TCTGCCCAGTGGCAGCAGACAGG - Intergenic
1022480625 7:30740999-30741021 CCGGCCCTGAGGCAGCAGCCAGG + Intronic
1022511358 7:30936865-30936887 ACTGGCCAGGGGCACCAACCTGG + Intergenic
1023157574 7:37266078-37266100 TCTGTCCTTGGGCAGCAGCCTGG + Intronic
1023889772 7:44383807-44383829 TCTGCCCTGAGCCACCACCCTGG - Exonic
1025710794 7:63906311-63906333 TCTAAGCTGGGGCAGCAACGCGG + Intergenic
1029372710 7:100159411-100159433 TCTGCCTTGGGGCAGGAAAGGGG + Exonic
1029728954 7:102426785-102426807 CCTGCCCTGAGTCTGCAACCTGG + Intergenic
1030055617 7:105581557-105581579 ACTGCCCTGTGGCTGCGACCCGG + Intronic
1033602548 7:142898637-142898659 TCTGCCCTGGGATGGCAGCCAGG - Intergenic
1034218294 7:149424134-149424156 TCTGCCCTGGGCAAGTCACCAGG - Intergenic
1035419108 7:158712188-158712210 TCTGCCCTGTGGCACCACCCAGG - Intergenic
1036612458 8:10362219-10362241 TCTGCACTGGGGCAGGCACTAGG - Intronic
1043216422 8:77595784-77595806 TTTCCCCTGGGGAAGCAACAAGG + Intergenic
1046454302 8:114438697-114438719 TCTGCCCTTGGGCAGCGGCGAGG + Intergenic
1048943821 8:139426524-139426546 TCTGCCCTGGGGCCAAACCCAGG + Intergenic
1049611895 8:143559693-143559715 TCTGCCCTGGGGCTGGGACAGGG + Intronic
1049973587 9:841897-841919 TCTGCCCTGCGGCGGTACCCCGG - Exonic
1053313269 9:37032763-37032785 TCTGCCCTGAGGCATGAATCAGG - Intronic
1053647582 9:40132158-40132180 GCTGCCCTGGGGCAGAACACTGG - Intergenic
1053758149 9:41331685-41331707 GCTGCCCTGGGGCAGAACACTGG + Intergenic
1054536997 9:66244012-66244034 GCTGCCCTGGGGCAGAACACTGG + Intergenic
1055341618 9:75290549-75290571 TGTGCCCTGAAGCAGCAACAGGG - Intergenic
1056208170 9:84340142-84340164 GCTGCTCTGGGGCAGGTACCGGG + Intronic
1057973430 9:99579094-99579116 TCTGTGCTGGGACAGGAACCAGG + Intergenic
1059463573 9:114450963-114450985 TCTGCCATGGGGCAGAAAAGGGG - Intronic
1060174442 9:121487045-121487067 TCTGCTTTGGGGCAGCATCGAGG - Intergenic
1060508746 9:124217013-124217035 GCAGCCTTGGGGCTGCAACCAGG + Intergenic
1061072073 9:128317012-128317034 TCAGCCTTGGGGCAGGAATCAGG + Intronic
1061188423 9:129068479-129068501 TCTGCCCTGGAGAAGCCTCCAGG + Intronic
1062112554 9:134790092-134790114 TCTGCCCTGGGACAGCAGGATGG - Intronic
1062293223 9:135807260-135807282 CTTGCCCTGTGGCAGCAACATGG + Intergenic
1202795362 9_KI270719v1_random:115450-115472 GCTGCCCTGGGGCAGAACACTGG - Intergenic
1185642660 X:1597230-1597252 TCTCCCCTGGGGAGGCAACGGGG - Intronic
1185775194 X:2797435-2797457 TCTGCCCTGGGCCTTCTACCTGG + Intronic
1186215260 X:7293175-7293197 TGTGCCCTTGGGCAGCCTCCTGG + Intronic
1188833516 X:34929769-34929791 TCTGTCCTGGGGCTGCAGCAAGG - Intergenic
1189239921 X:39517104-39517126 TCAGCCCTGGGGCAGGAACATGG + Intergenic
1190125201 X:47698629-47698651 TGGGCCCTGTGGCAGCACCCAGG - Intergenic
1197406947 X:126065210-126065232 TCTGCACTGGAGCAGGCACCAGG - Intergenic
1201068556 Y:10123385-10123407 TCTGTCCTGGGGCAGCCTCCAGG - Intergenic
1202232170 Y:22669096-22669118 TCTGCCCAGGTGAGGCAACCTGG + Intergenic
1202310986 Y:23527062-23527084 TCTGCCCAGGTGAGGCAACCTGG - Intergenic
1202559816 Y:26143532-26143554 TCTGCCCAGGTGAGGCAACCTGG + Intergenic