ID: 1017409042

View in Genome Browser
Species Human (GRCh38)
Location 6:154149836-154149858
Sequence CTGGAATAGTAGAGGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017409042 Original CRISPR CTGGAATAGTAGAGGCCAGA TGG (reversed) Intronic
900541326 1:3204477-3204499 CTGGAAGAGCAGAGGCCACCAGG + Intronic
900977407 1:6026156-6026178 CTGGATGAGCAGCGGCCAGATGG - Intronic
901886765 1:12229129-12229151 GTGGAATATTTGAAGCCAGAGGG + Intergenic
902221323 1:14967649-14967671 CCGGAGGAGCAGAGGCCAGAGGG + Intronic
902409295 1:16203477-16203499 CTGGAAGGGGAGAGGCCAGAGGG - Intronic
904515968 1:31055416-31055438 CTAGAATAGTTCAGTCCAGAAGG + Intronic
904841850 1:33377353-33377375 CTGGGATAGGAGATTCCAGAAGG - Intronic
907120033 1:52000264-52000286 CTGGAATAAAAGAGGCCCAAAGG - Intergenic
907338752 1:53718587-53718609 CTGAAAAAGTAGACTCCAGAGGG + Intronic
907880939 1:58548780-58548802 CTGAAGTAGTAGAAGCCAGGTGG - Intergenic
908592443 1:65648260-65648282 CAGTAATAATAGAAGCCAGAAGG - Intergenic
908703349 1:66925116-66925138 CTGGAATAGAAGGGGAGAGATGG - Intronic
909100170 1:71340256-71340278 CTGGAATAGAACAGTCCTGAGGG - Intergenic
909944562 1:81649175-81649197 CTGGGATGGTAGAGGCCTTAGGG - Intronic
911131345 1:94391492-94391514 CTGGAATGGAAGAGGTCAAATGG - Intergenic
911894101 1:103407042-103407064 CTGAAATAGTAGAGTCCAGGTGG + Intergenic
913696790 1:121334370-121334392 CAGAAATAATGGAGGCCAGAAGG - Intronic
914140770 1:144945690-144945712 CAGAAATAATGGAGGCCAGAAGG + Intronic
914797731 1:150935189-150935211 CAAAAATAATAGAGGCCAGAGGG - Intronic
915962217 1:160276403-160276425 CTGACATAGCAGAGGCCAGGTGG - Intergenic
916781940 1:168042624-168042646 CTGGAATAACAGAGTCTAGAAGG + Intronic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
918149340 1:181784712-181784734 CTGGGATAGGTGAGGCCAGATGG - Exonic
919799081 1:201341271-201341293 CAGGAATAGTGGAGACCAGAAGG - Intergenic
920484121 1:206352724-206352746 CAGAAATAATGGAGGCCAGAAGG - Intronic
921528878 1:216254627-216254649 CTGGAATATTAGAGGTTGGATGG + Intronic
921539926 1:216400750-216400772 CTGAAAAATTAGAAGCCAGAAGG + Intronic
921935225 1:220789322-220789344 CTGGCATAGTCAATGCCAGAGGG + Intronic
923068405 1:230540780-230540802 CTGAAATAATAGAGGTCAGAGGG + Intergenic
924405659 1:243742976-243742998 CTGCAACAGAAGAGGTCAGAAGG + Intronic
1063040672 10:2334043-2334065 CTCGAAAAGTAGAGGCCACATGG - Intergenic
1065071277 10:22026430-22026452 CAGAAATCGTGGAGGCCAGAAGG - Intergenic
1066454117 10:35558289-35558311 CTGGGAAAGAAGAAGCCAGAAGG + Intronic
1067000334 10:42605395-42605417 CAGAGACAGTAGAGGCCAGAAGG + Intronic
1067543765 10:47176961-47176983 CTGGCCTAGAAAAGGCCAGAAGG - Intergenic
1068730088 10:60348173-60348195 ATGAAATAGCAGAGGCAAGATGG - Intronic
1070543086 10:77431370-77431392 CTGGAATACCAGAGGCCTCAAGG - Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1076635231 10:131877388-131877410 GTTGAATAGGAGTGGCCAGAGGG - Intergenic
1077309097 11:1880655-1880677 ATGGAACAAAAGAGGCCAGAAGG - Intronic
1077990509 11:7406341-7406363 CTAGAATAGTAGATACCAGAGGG - Intronic
1078056447 11:8012885-8012907 CTGGGATAATAGAAGCCCGAGGG - Intergenic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079157793 11:17964638-17964660 CTGGAATATTAGAGTTGAGAGGG - Intronic
1080720977 11:34848339-34848361 CTGGAATAGCAGAGGCCAGGTGG + Intergenic
1081549963 11:44101763-44101785 CTGAGATAGTGGAGGCCAGTTGG + Intronic
1081797142 11:45828442-45828464 CTGGAAAACTGGAGGCCAGTGGG - Intergenic
1085706957 11:78794988-78795010 CTGGACAAGTAGCTGCCAGATGG + Intronic
1087610785 11:100432010-100432032 CTGGAATAGCAGAGGGCATGTGG - Intergenic
1087655758 11:100921022-100921044 CTGAAAAAGTAGAGGCACGAAGG - Intronic
1088044834 11:105436771-105436793 CTGAAATCATGGAGGCCAGAAGG - Intergenic
1090871263 11:130750798-130750820 CTGAAACAATGGAGGCCAGAAGG + Intergenic
1091454627 12:597868-597890 CTGGGCTATTACAGGCCAGAGGG + Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092245573 12:6862279-6862301 GAGGAGCAGTAGAGGCCAGAAGG - Intronic
1092897137 12:13022866-13022888 CAAGAATAGCAGAGACCAGATGG - Intergenic
1093805735 12:23431014-23431036 CTGGAATAATAGAGGTCAAGTGG + Intergenic
1093977867 12:25442316-25442338 CTGAAGTAATAGAGGCCAGGTGG - Intronic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1100140421 12:91612032-91612054 CTGGAAGATCAGAGGACAGAAGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1102663261 12:114547845-114547867 CTGGGCTAGAAGTGGCCAGAAGG - Intergenic
1102987303 12:117288833-117288855 CTGGAAGAGGAGAGACCACATGG + Intronic
1104205519 12:126634819-126634841 CTGTAAGAGCAGAGGCCAGCTGG - Intergenic
1105703554 13:22952238-22952260 CAGAAATAATAGAAGCCAGATGG + Intergenic
1106239285 13:27897087-27897109 CTGAAACAATGGAGGCCAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106761516 13:32873114-32873136 CCTGAATAACAGAGGCCAGATGG + Intergenic
1108768609 13:53666804-53666826 TTGCAATACTAAAGGCCAGAAGG - Intergenic
1111314377 13:86533776-86533798 CTGGAATGTCAAAGGCCAGATGG - Intergenic
1112384524 13:98926251-98926273 ATGTCATAGTAGAGGCCACATGG - Intronic
1116666361 14:47780915-47780937 TTGGAATAGTAGAGGCCACCAGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1116873960 14:50093082-50093104 CTGGACTAACAGAAGCCAGAGGG - Intergenic
1117051320 14:51862677-51862699 CGGGCATAGTAGAGTCAAGAGGG + Intronic
1117795373 14:59388330-59388352 CTGGAATAGTACTGGCCACAGGG - Intergenic
1118032184 14:61829234-61829256 CTAAAATCATAGAGGCCAGAAGG - Intergenic
1118960499 14:70525666-70525688 CTGGGATAGAAGAGGGGAGATGG - Intronic
1119673690 14:76538607-76538629 CTGGAATCATAGAAGCCAGTGGG - Intergenic
1120161696 14:81152566-81152588 CTGGAATGATAGAGGACAAATGG + Intergenic
1120903577 14:89598698-89598720 CTGGAACAATAGATGTCAGAAGG - Intronic
1121072518 14:91037404-91037426 TTGGAATGGCATAGGCCAGATGG - Intronic
1121247293 14:92471231-92471253 CTGGAGTTGCAGAGGCCAGTGGG - Intronic
1121564160 14:94896143-94896165 TTGGAAGACTAGAGGGCAGAAGG + Intergenic
1124884624 15:33673580-33673602 TTGGAAAAGTACTGGCCAGAAGG - Intronic
1125511557 15:40294960-40294982 CTGGAATGCTGGATGCCAGATGG - Exonic
1126134230 15:45375608-45375630 GTGGAATATTAGAGGATAGAGGG + Intronic
1126142543 15:45449978-45450000 CTGGAATGGGAGAGGCTCGAGGG + Intergenic
1128599038 15:68979932-68979954 CTGAAGTAGCAGAGGCCAGATGG - Intronic
1130028031 15:80286551-80286573 CAGGAATAGTGAAAGCCAGATGG - Intergenic
1130687207 15:86049085-86049107 CTTGAGTAGGAGGGGCCAGAAGG - Intergenic
1131074851 15:89488950-89488972 CTGGAATAGTTAAGGGTAGAGGG + Intronic
1131098336 15:89669868-89669890 CTGGAATAGGGAAGGCCAGTGGG - Intronic
1135304516 16:21356562-21356584 CTGGCAAAGCAGAGGCCACAGGG - Intergenic
1136301259 16:29335692-29335714 CTGGCAAAGCAGAGGCCACAGGG - Intergenic
1137964508 16:52917090-52917112 CTGGGATTTTAGAGGCCAGATGG - Intergenic
1138424801 16:56924190-56924212 CTTGAATAGGAGACACCAGAGGG - Intergenic
1139013804 16:62665369-62665391 CTGGAAAAAGAAAGGCCAGAAGG - Intergenic
1139666349 16:68459582-68459604 TAGGGATAGCAGAGGCCAGAGGG + Intergenic
1139786179 16:69394232-69394254 CTGGTTTAGTAGGGCCCAGAGGG + Intronic
1141672380 16:85499047-85499069 CAGGAGGAGTTGAGGCCAGATGG + Intergenic
1142062957 16:88042428-88042450 CTGGCAAAGCAGAGGCCACAGGG - Intronic
1146696036 17:34909679-34909701 CTGGGTTACTAGAGTCCAGATGG - Intergenic
1147401331 17:40181712-40181734 TTGGAAAAGGAGAGGTCAGAAGG + Intronic
1147805102 17:43125622-43125644 CTGGAAGAGTAGAGGCTAGAGGG - Intergenic
1147811105 17:43170439-43170461 CTGGAAGCGTAGAGGCGAGAGGG - Intergenic
1147850692 17:43440333-43440355 CTAGAGCAGAAGAGGCCAGAAGG + Intergenic
1148772733 17:50076498-50076520 CTGGAAGACCAGGGGCCAGAAGG + Intronic
1148809910 17:50283762-50283784 GTGGAACAGCAGATGCCAGAAGG - Intergenic
1151055209 17:71022822-71022844 TTGAGATAGTAGAGGACAGATGG - Intergenic
1152486846 17:80600145-80600167 TTGGACTCTTAGAGGCCAGACGG - Intronic
1155071710 18:22322561-22322583 CTGAAATATTAGAGGTCAGCTGG + Intergenic
1156893633 18:42217933-42217955 TGGGAATAGTAGAGGCCAGGTGG - Intergenic
1157624182 18:49035562-49035584 CTAGAATGGTAGAATCCAGATGG - Intergenic
1158234081 18:55293660-55293682 CTGAAATAGTAGGGGCCCTAAGG + Intronic
1159969638 18:74633587-74633609 TTGTAATACTAGAGGCCAAAAGG - Exonic
1160271479 18:77388781-77388803 CTGTTGCAGTAGAGGCCAGAAGG - Intergenic
1160606638 18:80056277-80056299 CAGAAATAATGGAGGCCAGAAGG - Intronic
1161394550 19:4038244-4038266 CTGGAATGGTCGTGGGCAGAGGG - Exonic
1162090372 19:8275847-8275869 GTGGAATGCTTGAGGCCAGAAGG - Intronic
1162092605 19:8290680-8290702 GTGGAATGCTTGAGGCCAGAAGG - Intronic
1162496334 19:11025197-11025219 CTGGCACAGCAGAGGGCAGATGG - Intronic
1163397971 19:17075349-17075371 CTGGATTTGTAGACGCCATAGGG - Intronic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1167942907 19:52962155-52962177 CTGGACTAGTATAGTCCAGCGGG - Intronic
925186074 2:1847321-1847343 CGGGAACCGTAGAGGCCACAGGG + Intronic
925427090 2:3758848-3758870 CTGGAAGATGAGAGGCCACATGG - Intronic
926964582 2:18396138-18396160 CTGGAATTGTCTAAGCCAGATGG + Intergenic
927048038 2:19299713-19299735 GTGGAATAGTACAGGACAGGGGG + Intergenic
928291009 2:30037406-30037428 CTGGAATGATGGTGGCCAGATGG - Intergenic
929880861 2:45836556-45836578 CTGGCATGGGAGAGGCCAGCTGG - Intronic
931382351 2:61765190-61765212 CTATAATAATAGTGGCCAGAGGG - Intergenic
934619910 2:95797647-95797669 CTGGAATAGGAGGGGTCAGAGGG - Intergenic
934640978 2:96026910-96026932 CTGGAATAGGAGGGGTCAGAGGG + Intronic
935002148 2:99029050-99029072 CAGGAAAAGAAAAGGCCAGAAGG + Intronic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
936717288 2:115202511-115202533 CTCGAAAAGTAGAGGCAAGTAGG - Intronic
937563331 2:123252589-123252611 CTCAAATAGTAGAGGCCAGTAGG - Intergenic
938261681 2:129901038-129901060 CAGGAATGGTAGAGGGCAGCAGG + Intergenic
938836408 2:135107045-135107067 CAGAAACAGTGGAGGCCAGAGGG + Intronic
940051005 2:149464763-149464785 ATGGAATAGAAAAGACCAGATGG + Intronic
941231168 2:162914020-162914042 CTAAAACAATAGAGGCCAGATGG + Intergenic
941594593 2:167459941-167459963 CCAGAATTTTAGAGGCCAGAAGG - Intergenic
943444518 2:187967504-187967526 CTGGAATGTTAGAGGCCAGTTGG + Intergenic
944919986 2:204402792-204402814 CTGGCATAAGAGAGGCCAGGTGG - Intergenic
945107285 2:206328026-206328048 CTGAAATAGTACAGGCCAGGTGG - Intergenic
945148086 2:206759783-206759805 CTGAAACAATAGAGGCCAGTGGG + Intronic
945472031 2:210238344-210238366 CTAGACTAATAGAGGCCAGATGG - Intergenic
945596661 2:211803933-211803955 CATGAACAGTAGAGACCAGAAGG + Intronic
945837377 2:214849056-214849078 CTGAAATAACAGAGGCCAGGTGG - Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
948575301 2:238946040-238946062 CTGGTTTAGCAGAGGCCAGCAGG - Intergenic
948774060 2:240271854-240271876 CAGAAATAATGGAGGCCAGAAGG - Intergenic
1169525021 20:6415058-6415080 CTGCAATAAAAGGGGCCAGAGGG + Intergenic
1176061101 20:63173337-63173359 CTGGAGGAGTCGAGGCCACAAGG + Intergenic
1178566026 21:33686542-33686564 CTGAAAATGGAGAGGCCAGAAGG - Intronic
1183275362 22:36893244-36893266 ATGGCATAGTAAAGGCCAGCTGG + Intergenic
1184001643 22:41678722-41678744 CTGGTATAGCAGTGGCCAGTGGG - Intronic
1184986562 22:48140072-48140094 CTGGACTAGAAGAAGCCGGAAGG + Intergenic
950225826 3:11233788-11233810 CTCTACTAGCAGAGGCCAGATGG - Intronic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
951156316 3:19358078-19358100 CAGCAACAGTAGAGGCCAAAAGG + Intronic
951811085 3:26700962-26700984 AAGGAACAGTAGAGGCAAGAAGG - Intronic
951871588 3:27368398-27368420 CTAGAATCGGAGAAGCCAGATGG + Intronic
954529491 3:51306256-51306278 CAGATATAGTGGAGGCCAGAAGG - Intronic
958052978 3:88371865-88371887 CAGAAATAATAGAGGCCAGGAGG + Intergenic
958088388 3:88843164-88843186 CTGGAAGAGTGGAGGACAGGAGG + Intergenic
958652851 3:96960457-96960479 TAAGAATAGCAGAGGCCAGATGG - Intronic
959127566 3:102308294-102308316 CTGGGATAGTGGTGGCCAAAAGG + Intronic
960754509 3:120996078-120996100 CTGAAACTATAGAGGCCAGAAGG - Intronic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
961646933 3:128397717-128397739 CTTGATGAGTAGAGGCCAGCTGG - Intronic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
970469193 4:16359053-16359075 CTGGAAAAGAAGAGGCCAGGAGG - Intergenic
974825223 4:67119715-67119737 CTGGAATTGTAGTAGCAAGATGG + Intergenic
975043807 4:69777114-69777136 ATTGAACAATAGAGGCCAGAAGG + Intronic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
977175538 4:93815500-93815522 CTGGGATAGTAGAAGCCAGGTGG + Intergenic
979751075 4:124279350-124279372 TTGGAATAGGAAAGGCCAGAGGG + Intergenic
980192633 4:129544448-129544470 CTGGAATATTATAGGTAAGAAGG + Intergenic
980771726 4:137381783-137381805 CTGGAATAGTATAGAAAAGAGGG - Intergenic
981140281 4:141259718-141259740 CTGGAACAGTGGAGGCCACAAGG + Intergenic
982694368 4:158582652-158582674 CAGGAATAGTAGAGGAGAAATGG - Intronic
982787004 4:159547870-159547892 CTGAAATAGCAGAGGCCAGATGG - Intergenic
982849594 4:160296007-160296029 ATAGAATATGAGAGGCCAGATGG - Intergenic
982887352 4:160798293-160798315 CTGGTATATTTGAGGTCAGATGG - Intergenic
983719674 4:170833925-170833947 CAGGAATTGTACAGGCCAGCAGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986380795 5:7183586-7183608 CTGGAACACCAGAGGCCAGGAGG + Intergenic
986637481 5:9837323-9837345 CTAGAATAGCAGAGGCCACATGG + Intergenic
986889849 5:12289178-12289200 TTGAAAAGGTAGAGGCCAGAGGG - Intergenic
986955297 5:13143218-13143240 CTGGATTAGTACTTGCCAGAAGG + Intergenic
987825624 5:23026956-23026978 CCAGAGTACTAGAGGCCAGATGG - Intergenic
994939380 5:106302015-106302037 CTGTAACATTAGAGTCCAGATGG - Intergenic
995943159 5:117609319-117609341 TTGGCATGGCAGAGGCCAGAAGG - Intergenic
996682505 5:126243114-126243136 CAGAGATAGTGGAGGCCAGAAGG - Intergenic
997238450 5:132289460-132289482 CTGGAATTGCAGAGACTAGATGG + Intronic
997753408 5:136371838-136371860 CTGAAAAAATAGAGGCCAGGTGG + Intronic
1000309419 5:160027789-160027811 CCAGAACAGTGGAGGCCAGAAGG - Intronic
1004953807 6:20704535-20704557 CTGGAATAGAAAGTGCCAGAGGG + Intronic
1007160056 6:39783524-39783546 CTGAAACAATGGAGGCCAGAAGG - Intergenic
1007595817 6:43050681-43050703 ATGGAGTGGTGGAGGCCAGAAGG - Intronic
1008237324 6:49065865-49065887 CTGAAATAATAGAGGCCAGGTGG + Intergenic
1012814433 6:104004242-104004264 CTAGAATAGTAGCTGCCAGAAGG - Intergenic
1012938146 6:105389671-105389693 CTGAAAACGTAGTGGCCAGATGG + Intronic
1014074990 6:117225420-117225442 TTGTAATATTAGAGGCCAGGAGG - Intergenic
1014080670 6:117282726-117282748 CTAAAGTAATAGAGGCCAGATGG - Intergenic
1016868179 6:148790376-148790398 CTGGAATAGTAGAGACCACAAGG + Intronic
1017409042 6:154149836-154149858 CTGGAATAGTAGAGGCCAGATGG - Intronic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1019462074 7:1165371-1165393 CTGGAATATCTGAGGCCAGGAGG - Intergenic
1021273955 7:18626194-18626216 CTGGAATAGTGGCTTCCAGAGGG + Intronic
1024345716 7:48310910-48310932 TTCAAACAGTAGAGGCCAGAAGG - Intronic
1024345723 7:48310963-48310985 TTCAAACAGTAGAGGCCAGAAGG - Intronic
1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG + Intergenic
1027883545 7:83873764-83873786 CTGATATAATAGAGGCCAGCTGG + Intergenic
1029139763 7:98401241-98401263 CTGGAATGGGCGTGGCCAGAGGG + Intergenic
1029894410 7:103967282-103967304 CTGGAGTTGTAGAGGCCTGAGGG - Intronic
1030826457 7:114165235-114165257 GTGGAATAGGAGAGGTGAGAAGG - Intronic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1032109669 7:129065096-129065118 CTGCTATAGTAAAGGCCAAATGG + Intergenic
1032435852 7:131899773-131899795 CAGGAGTGGTAGAGGCCAGCAGG + Intergenic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1033615892 7:143013724-143013746 CTAGAACAGCAGAGGCCAGGTGG - Intergenic
1034269114 7:149795164-149795186 CTGGAGTAGGGGAGGACAGAGGG - Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1037138870 8:15496003-15496025 CTGGAACAGTAGAGGCCACTTGG - Intronic
1039186941 8:34928073-34928095 TTGGAATAGTACCTGCCAGATGG - Intergenic
1041465312 8:58152559-58152581 CTGGAAAAGGAAAAGCCAGAAGG + Intronic
1043093721 8:75937761-75937783 CTGGAATAGCAAAGTCCAGGTGG - Intergenic
1043104236 8:76088364-76088386 CAGAAATACTACAGGCCAGAAGG - Intergenic
1043589535 8:81812482-81812504 CAGAAATAATAGGGGCCAGAAGG + Intronic
1044249380 8:89988382-89988404 CTGAAATGATAGAGGCCAGCTGG - Intronic
1044261781 8:90133384-90133406 CAGGAATAGAAGAGGCAAAATGG + Intergenic
1044530510 8:93301684-93301706 CTAGAATGGTAGATGCCACATGG + Intergenic
1044846888 8:96390565-96390587 CTGGAATTGCTAAGGCCAGAGGG + Intergenic
1048970948 8:139644741-139644763 CTGGGATTGTAGCAGCCAGAGGG - Intronic
1049228650 8:141470668-141470690 CTGGAACAGCAGAGACCAGAAGG - Intergenic
1049910169 9:258199-258221 CTTGAATAGCAGAGGCTGGAAGG + Intronic
1051617201 9:19017571-19017593 CAGGTATAGGAGAGGCCAGAAGG - Intronic
1051722509 9:20053102-20053124 CTAGAATATTAGAGACAAGATGG - Intergenic
1051767432 9:20540352-20540374 CTGGAAGGGTGGAGGCCACATGG - Intronic
1053185985 9:36016868-36016890 CCAGAATAGTAGAGGCCTGATGG - Intergenic
1055474345 9:76646668-76646690 CTGGGGGAGTAGAGACCAGATGG - Intronic
1057370187 9:94464329-94464351 TTGGGATCATAGAGGCCAGAAGG + Intergenic
1059820061 9:117962704-117962726 ATGTAATAGTAGATGCCAGAGGG + Intergenic
1062699536 9:137891705-137891727 CTGGACTAGAAGAGGTGAGAAGG + Intronic
1187282926 X:17875311-17875333 CTGAAACCGTGGAGGCCAGAAGG - Intergenic
1187927029 X:24260114-24260136 CTCACATAGTAGAGGGCAGAGGG + Intergenic
1193747647 X:85301309-85301331 CAGAAATTATAGAGGCCAGAAGG + Intronic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1194647577 X:96476345-96476367 CTGGAATAATAGAAGACAGCTGG + Intergenic
1195655699 X:107329575-107329597 GTGGAATATTAAAAGCCAGATGG + Intergenic
1196936331 X:120734652-120734674 CTGGCATGGCAGTGGCCAGAGGG + Intergenic
1197202055 X:123756869-123756891 CTGAAAGAGCAGAGGCCAGGTGG + Intergenic
1197866559 X:131025320-131025342 CTGGAAAGGCAGAGCCCAGAGGG + Intergenic
1197927383 X:131661298-131661320 CTGGAATGCCAGAGGCCACATGG + Intergenic
1198705305 X:139442496-139442518 CAGAAATATTACAGGCCAGAAGG + Intergenic
1200172241 X:154085724-154085746 GTAGAATAGTAGTTGCCAGAGGG + Intronic
1200290080 X:154863503-154863525 CTGGAGTAGCAGAGCCCAAATGG - Intronic
1200315637 X:155129947-155129969 CAGAAATCATAGAGGCCAGAAGG + Intronic
1201057078 Y:10005185-10005207 CTGGAAGAGTAGAGAGCAGCTGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1202167933 Y:22012784-22012806 AAGGAATAGTAGAGACCAGTGGG - Intergenic
1202223428 Y:22573584-22573606 AAGGAATAGTAGAGACCAGTGGG + Intergenic
1202319687 Y:23622076-23622098 AAGGAATAGTAGAGACCAGTGGG - Intergenic
1202551081 Y:26047980-26048002 AAGGAATAGTAGAGACCAGTGGG + Intergenic