ID: 1017410381

View in Genome Browser
Species Human (GRCh38)
Location 6:154161738-154161760
Sequence CGTTAGGTGCAGGGAATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017410381 Original CRISPR CGTTAGGTGCAGGGAATACA GGG (reversed) Intronic
901349849 1:8584886-8584908 CCTTAAGTGCTGGGATTACAAGG - Intronic
902412201 1:16218034-16218056 AGGTAGATGAAGGGAATACAGGG - Intergenic
902665350 1:17933795-17933817 AGTTTGGTGGAGGGAATAAAAGG + Intergenic
906790761 1:48656948-48656970 TTTTAGATTCAGGGAATACATGG - Intronic
908813740 1:68010685-68010707 TGTTTTGTGCAGGAAATACAAGG - Intergenic
909420495 1:75459476-75459498 TGTCAGGTGCTGGGAATAGAAGG - Intronic
909789512 1:79657630-79657652 CATTAGGGGCTGGCAATACATGG + Intergenic
910334586 1:86112610-86112632 CGTTACTTGCAGGGCATACCAGG - Exonic
919114161 1:193259856-193259878 TTTTAGTTGCTGGGAATACAGGG + Intergenic
919827021 1:201510290-201510312 CTCTAGGTTCTGGGAATACAAGG + Intergenic
920084866 1:203407988-203408010 TGTGAGGGGCAGGGGATACATGG - Intergenic
920606656 1:207395294-207395316 GTATAGGGGCAGGGAATACATGG + Intergenic
923115646 1:230935247-230935269 TGTGAGGTGCAGGGAAGGCAAGG + Intronic
1063445780 10:6115021-6115043 TGTTAGGTGCCAGGAACACAGGG - Intronic
1063819268 10:9816139-9816161 TTTTAGGTTCAGGGACTACATGG + Intergenic
1070549773 10:77482010-77482032 CGTTAGCTGAAGGCAATGCAGGG - Intronic
1070627722 10:78063061-78063083 TGATAGGTGCTGGGGATACAGGG + Intergenic
1072140449 10:92584716-92584738 CCTTAAGTGCTGGGATTACAGGG - Intergenic
1074137286 10:110638644-110638666 CCCAAGGTGCTGGGAATACAGGG - Intergenic
1075923238 10:126230273-126230295 TGTTAGCTGCAGGAAATATAAGG - Intronic
1077881366 11:6353313-6353335 AGTTAGGTGCTGAGGATACAAGG - Intergenic
1080739991 11:35055037-35055059 ACTTAGGTGCAGAGAATTCAGGG - Intergenic
1081413057 11:42782745-42782767 CATTTGGTGCTGGGAGTACATGG - Intergenic
1084202518 11:67570312-67570334 CCCAAGGTGCAGGGATTACAGGG + Intergenic
1084377247 11:68786100-68786122 CCTGAAGTGCTGGGAATACAGGG - Intronic
1085422947 11:76379966-76379988 TGTTAGGTGCTGGGAGTTCATGG - Intronic
1087047081 11:93851139-93851161 TGTTAAGTGCTGGGGATACAAGG + Intergenic
1090441518 11:126728855-126728877 TGTGGGGTGCAGGGAATTCAGGG - Intronic
1095193227 12:39283086-39283108 TGTTAGATGCAAGGGATACAGGG + Intergenic
1095681343 12:44980109-44980131 CGTGTGGGGCAGGGAACACATGG - Intergenic
1096001509 12:48134296-48134318 CGCTAGGTCCACGGAATAAATGG - Intronic
1096290698 12:50340366-50340388 TGTTAGGTACAGGGATTAGAGGG - Intronic
1099330992 12:81286919-81286941 TGTTAGAAGCAGGGAATACAAGG - Intronic
1099940862 12:89186737-89186759 CATTAGGGGCAGGGAACACTTGG - Intergenic
1100363042 12:93895365-93895387 CCTGAGGTACAGGAAATACAAGG + Intergenic
1102186899 12:110956217-110956239 CGTGAGTAGCAGGGACTACAGGG - Intergenic
1102417341 12:112775390-112775412 TGTTAGGTCCTGGGAATCCAGGG + Intronic
1108116994 13:47139802-47139824 CGTTGTGTGCAGGGATCACATGG - Intergenic
1110580118 13:77111862-77111884 CTTTATGTGCAGTGAATAAATGG - Intronic
1111456695 13:88493726-88493748 GGTAAGGTCCAGGTAATACAGGG - Intergenic
1114434915 14:22698080-22698102 GTGTAGGTGCAGGGAATATATGG + Intergenic
1114779769 14:25525588-25525610 CGTTACGTACAGAGAATAAATGG - Intergenic
1115499129 14:34033921-34033943 TATTATGTGCTGGGAATACAGGG + Intronic
1116818855 14:49608584-49608606 TGCTAGGAGCAGGGTATACATGG - Intronic
1120074564 14:80140891-80140913 AGGAAGGTGAAGGGAATACAAGG - Intergenic
1122705544 14:103618660-103618682 CCTTAGGAGCTGGGATTACAGGG - Intronic
1129382426 15:75176682-75176704 CTGTAAGGGCAGGGAATACATGG + Intergenic
1129490676 15:75922580-75922602 GGTTATGTGCAGGGAAGTCATGG + Intronic
1130447268 15:84014898-84014920 TGTTAGGTGCTGGGAATACGGGG - Intronic
1137836063 16:51593894-51593916 CCTTAGGTGCTGGGCAGACATGG + Intergenic
1142870544 17:2817251-2817273 CCTAAGGTGCTGGGATTACAGGG + Intronic
1149529854 17:57386513-57386535 TTTTAGGTGCTAGGAATACAGGG + Intronic
1150439178 17:65177519-65177541 TGTTAGGTGCTGGGGATACTGGG + Intronic
1150735686 17:67736184-67736206 CCTTAAGTGCTGGGATTACAGGG - Intronic
1151300783 17:73223854-73223876 CCTGAGGTGCTGGGACTACAGGG - Intronic
1156281904 18:35647373-35647395 TGTCAAATGCAGGGAATACAAGG - Intronic
1159881495 18:73862380-73862402 CGTGATGTGCTGGGATTACAGGG + Intergenic
1160789725 19:917892-917914 CCTCAGGTGCAGGGACCACAGGG - Intronic
1167534778 19:50042749-50042771 TGTCAGGAGCTGGGAATACAGGG - Intronic
925681239 2:6423675-6423697 CGTTACGTGCAGGGCCTACAAGG + Intergenic
926428209 2:12759205-12759227 CATTAGGTACATGGAACACAAGG - Intergenic
926793987 2:16603732-16603754 CCTTAAGTGCTGGGAATACAAGG - Intronic
926838113 2:17046751-17046773 ATTTAGATGCAGGGAAGACAAGG - Intergenic
928214200 2:29347643-29347665 CCTAAGATGCAGGGAATACTTGG + Intronic
928457438 2:31435237-31435259 CGTTAGCTGAGAGGAATACAGGG + Intergenic
930929039 2:56858724-56858746 CCTAATGTGCAGGGATTACAGGG + Intergenic
935259376 2:101341910-101341932 CGTGAGGACCAGGGAAGACACGG + Intergenic
938639945 2:133267165-133267187 CGTTAGGGGCAGACAATAGAAGG - Intronic
940842205 2:158597130-158597152 TGTTAGAGGCTGGGAATACATGG - Intronic
941106972 2:161364978-161365000 CCTGAGGTGCTGGGATTACAAGG - Intronic
948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG + Intronic
1170329988 20:15198268-15198290 CCTTAAGTGCTGGGATTACAAGG + Intronic
1173325680 20:42031149-42031171 AGTTAGATGCTGGGAATTCAGGG + Intergenic
1173977167 20:47195756-47195778 GGAGAGGTGCAGGAAATACACGG + Intergenic
1177732634 21:25048050-25048072 TGATAGGTGCTGGGGATACAAGG - Intergenic
1178517874 21:33264116-33264138 CGTAAAGTGCTGGGATTACAGGG + Exonic
1182371864 22:29816905-29816927 CCTTAGATGCTGGGATTACAGGG - Intronic
949408733 3:3741397-3741419 AGCTAGGTCCTGGGAATACATGG - Intronic
950423196 3:12910628-12910650 CGTGGGGAGCAGGGCATACAGGG + Intronic
950736499 3:15013129-15013151 CCTTAGGTTGAGAGAATACAGGG - Intronic
951590229 3:24256440-24256462 AGTTCGTTGCAGGGAATAAATGG + Intronic
955275946 3:57546886-57546908 CCTAAGGTGCTGGGATTACAGGG - Intergenic
956617790 3:71190240-71190262 TGTTAGGTGCTAGGAAAACATGG - Intronic
961548959 3:127656074-127656096 TGTTAGGTGCTGGGAATGTAGGG + Intronic
963278428 3:143356772-143356794 CCTAAGGTGCTGGGATTACAGGG + Intronic
963406324 3:144868259-144868281 CATTATGTGCAGAGATTACATGG - Intergenic
969364262 4:6684909-6684931 CGCTAGGTGCTGGGGATACCGGG - Intergenic
970313278 4:14804938-14804960 CTTTAGGTGCTGGGAATAAAGGG - Intergenic
974800770 4:66815018-66815040 TGTTAGGTGCAGGGGATACAGGG - Intergenic
979718729 4:123872947-123872969 CTTTAGGTTCAGTGAATTCAGGG + Intergenic
980468167 4:133213940-133213962 AGTTGGGTCCAGGAAATACATGG + Intergenic
999335747 5:150714878-150714900 CCTTAGGTGGAGGGAACAAAGGG - Intronic
1006320369 6:33316178-33316200 CGACAGGGGCTGGGAATACAGGG + Exonic
1006799188 6:36748772-36748794 AGTTAGTTACAGGAAATACAAGG + Intronic
1010393886 6:75368537-75368559 CCTTAGGTGGAGGAAATACTTGG + Intronic
1010606512 6:77895698-77895720 GGGTAGGTGCTGGGGATACAGGG - Intronic
1017410381 6:154161738-154161760 CGTTAGGTGCAGGGAATACAGGG - Intronic
1017573608 6:155776245-155776267 CGTTAGGTTAAGAAAATACAGGG + Intergenic
1019214550 6:170434880-170434902 CTTCAGGTGGAGGGAATGCAGGG - Intergenic
1020253131 7:6484983-6485005 CCTTAAGTGCTGGGATTACAGGG - Intergenic
1023976752 7:45036153-45036175 CGTGAGATGCAGGAAACACAGGG + Intronic
1024721802 7:52145168-52145190 CCTTAGGTGCAGGTATGACATGG + Intergenic
1027491113 7:78827534-78827556 CCTAATGTGCTGGGAATACATGG + Intronic
1028520584 7:91726304-91726326 CATAAGGTGCTGGGATTACAAGG - Intronic
1032123870 7:129176709-129176731 CATGAGGTGCTGGGACTACAAGG + Intergenic
1033771787 7:144560417-144560439 TATTCGGTGCAGGGAATGCAAGG - Intronic
1037771973 8:21807004-21807026 CGTTAGGTACAAGAGATACAAGG - Intronic
1039124891 8:34190388-34190410 CATGAAGTGCAGTGAATACATGG - Intergenic
1039788862 8:40858056-40858078 ATTTGGGTGGAGGGAATACAAGG + Intronic
1041282857 8:56229033-56229055 CGTTAGGGGTGGGGAATAAAGGG + Intergenic
1042773354 8:72402874-72402896 TGCTAGGTGCAGGGAATGCTTGG - Intergenic
1044724610 8:95183072-95183094 TGTTTGGGGCAGGGAATAGATGG + Intergenic
1045788243 8:105951052-105951074 CCTTAAGTGCTGGGATTACAAGG - Intergenic
1050564791 9:6870825-6870847 AGTTAGGCGCAGGGAGTATAGGG + Intronic
1051335508 9:16062530-16062552 TTTTAGGTTCAGGGCATACAGGG - Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055830324 9:80370574-80370596 CTTTAGGTTCAGGGAATATAAGG - Intergenic
1056298353 9:85216624-85216646 TGCTAGGTGCTAGGAATACACGG - Intergenic
1058083495 9:100723699-100723721 TGGTAGGTGCTGGGGATACAAGG + Intergenic
1060099949 9:120831203-120831225 CAGTAGGTGCTGGGAATATAAGG - Intronic
1060583225 9:124770643-124770665 GGTTCGGTGCTGGGAAGACAGGG + Intronic
1193456687 X:81739995-81740017 AATTAGATTCAGGGAATACATGG + Intergenic
1197278224 X:124504845-124504867 CATTAGGTGAAGGGAAAAGATGG + Intronic
1197324031 X:125069595-125069617 TGTTGGGGGCTGGGAATACAGGG + Intergenic