ID: 1017415520

View in Genome Browser
Species Human (GRCh38)
Location 6:154216515-154216537
Sequence GTTTTTGTATGTGCATGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017415518_1017415520 6 Left 1017415518 6:154216486-154216508 CCTGATCCACTGTACTTCAAAAA 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1017415520 6:154216515-154216537 GTTTTTGTATGTGCATGAATTGG No data
1017415519_1017415520 0 Left 1017415519 6:154216492-154216514 CCACTGTACTTCAAAAACGATAT 0: 1
1: 1
2: 0
3: 14
4: 143
Right 1017415520 6:154216515-154216537 GTTTTTGTATGTGCATGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017415520 Original CRISPR GTTTTTGTATGTGCATGAAT TGG Intronic
No off target data available for this crispr