ID: 1017415828

View in Genome Browser
Species Human (GRCh38)
Location 6:154219573-154219595
Sequence CTGTGTAAGTGGGATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017415828_1017415834 0 Left 1017415828 6:154219573-154219595 CCTTCCACATCCCACTTACACAG 0: 1
1: 0
2: 1
3: 41
4: 344
Right 1017415834 6:154219596-154219618 CAAGGGCTTTGCTAACCAACAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017415828 Original CRISPR CTGTGTAAGTGGGATGTGGA AGG (reversed) Intronic
900790569 1:4677237-4677259 CTGGGTAAGTGACATGTGGCTGG + Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901396907 1:8988397-8988419 CTGTTCCAGTGGGATGTGGGGGG + Intergenic
905858695 1:41331630-41331652 GGGTGGAAGTGGGTTGTGGAGGG - Intergenic
907810318 1:57863266-57863288 GTGTGTATGGGGGATGTGTAAGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
911064229 1:93773434-93773456 CTGTGCAGGTGGGAAGGGGAGGG + Intronic
911366521 1:96945585-96945607 TTGAGTCAGTGGGGTGTGGAAGG - Intergenic
911910701 1:103631003-103631025 TTTTCTAAGTGGGATGTGTAGGG - Intergenic
911918116 1:103725128-103725150 TTTTCTAAGTGGGATGTGTAGGG - Intronic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912755462 1:112321389-112321411 CTGTGGAAGTGGCCTGTGAAGGG - Intergenic
914416795 1:147491375-147491397 CTGTGGAACTGGGAAGTGGTGGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915560098 1:156682117-156682139 CTGTCTAGCTGGGAAGTGGAGGG - Intergenic
916849277 1:168686560-168686582 GTGTGTAAGTGGAATTTGAAGGG + Intergenic
916962688 1:169905137-169905159 GTGTGTATGTGGGGTGAGGAAGG - Intergenic
917295097 1:173510601-173510623 CTGTGTAAGTTTGCTGAGGATGG + Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918958321 1:191238589-191238611 CTGGGCAAGAGGTATGTGGATGG + Intergenic
920231617 1:204474420-204474442 CAGTTTTAGTGGGATGTGGGGGG - Intronic
921191007 1:212708736-212708758 CTGTGGAAGTTGGATGGGGGCGG - Intergenic
922130463 1:222772228-222772250 CTGTGTAAGTGTTGTGTGGGGGG + Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922931946 1:229396890-229396912 CAGGGTAAGTGGGCTGAGGATGG - Intergenic
923299379 1:232627546-232627568 CTGTGTAATATGGATTTGGAAGG - Intergenic
1063348912 10:5336652-5336674 GTGTGTATGTGTGTTGTGGAGGG + Intergenic
1063356817 10:5408403-5408425 GTGTGTATGTGTGATGTGGGGGG - Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1066293114 10:34031676-34031698 CAGTGTAAGTGGGCAGTAGAAGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067449908 10:46375869-46375891 CTGGGTAAGTGGGAGCTGGCAGG + Exonic
1067587338 10:47483894-47483916 CTGGGTAAGTGGGAGCTGGCAGG - Exonic
1067634397 10:47991661-47991683 CTGGGTAAGTGGGAGCTGGCAGG - Intergenic
1067910593 10:50342945-50342967 TTGGGTAGGTGGGAAGTGGATGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071670287 10:87602804-87602826 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1072253405 10:93599831-93599853 CTGTGAAAATCAGATGTGGAGGG - Intronic
1072843947 10:98807335-98807357 CTGGATAGGTGGGAAGTGGATGG - Intronic
1072999307 10:100274669-100274691 CTGTGTATGTAGGATTTGGGGGG - Intronic
1073426728 10:103459547-103459569 GTGTGTTTGTGGGCTGTGGATGG + Intergenic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1074174334 10:110980932-110980954 CAGTGTAAGTTTCATGTGGATGG + Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075612553 10:123865398-123865420 CTGTCTAAGTTGGCTGTGGTAGG - Intronic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1077273314 11:1691901-1691923 CTGTGTAGGTGGGATCCAGAGGG + Intergenic
1077305118 11:1865487-1865509 CAGTGCAGGTGGGATGGGGAAGG - Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1078466368 11:11553412-11553434 CTGTGGAGGTGGGCTTTGGAGGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1083241309 11:61391149-61391171 CTGGCTAATTGGGATGTGGTGGG - Intergenic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1084716584 11:70878171-70878193 TTTTGTAAGAGAGATGTGGATGG - Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1088431917 11:109768289-109768311 CGCTTTAAGAGGGATGTGGAGGG - Intergenic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1098661823 12:73103963-73103985 CTGAGTAAGTGGCCTTTGGATGG - Intergenic
1099119004 12:78664663-78664685 CTGTGTAAAAGGGATGGGGTAGG - Intergenic
1099455858 12:82862013-82862035 CTGAGTTAGTGGGGTCTGGAAGG + Intronic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1101847332 12:108373022-108373044 CGGTGGAAGTGGGTTGTAGAGGG + Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102969388 12:117154270-117154292 CTGTCTCAGTGTGATGGGGATGG - Intronic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1105356663 13:19665115-19665137 CTCTGGAAGTGGGTTGGGGAGGG + Intronic
1105720074 13:23104508-23104530 CTGTGTATGTTGGATGGTGATGG + Intergenic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1106910822 13:34461736-34461758 GTGTGTAACTGTGAAGTGGAGGG + Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107850420 13:44566910-44566932 CTATATAAGTGGGATGTGGGGGG + Intronic
1108592759 13:51925505-51925527 GTGTGTATGTGTGATGTGTAGGG - Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1110064416 13:71085875-71085897 CAGTGTGAGTGTGATGTAGATGG + Intergenic
1110486631 13:76052003-76052025 CTGTTTCAGTGGGGTGTGTAGGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1114407632 14:22471630-22471652 ATGTGGAAGAGGGATGTTGAGGG + Intergenic
1114454205 14:22844945-22844967 CCGTGTGAGTGGGATGTGACCGG + Intronic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1116058989 14:39897558-39897580 TTGGGTAAGAGGTATGTGGATGG + Intergenic
1117704940 14:58455772-58455794 CTGTGCAAGTAGGAAGTGAAAGG - Intronic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1118874457 14:69771561-69771583 CTGTGGGGGTGGGATTTGGAAGG + Exonic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1119905607 14:78299001-78299023 CTGTGGAAGTGGGCAGTCGAGGG + Intronic
1120026560 14:79592008-79592030 CTTTGTTATAGGGATGTGGATGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1121694576 14:95902453-95902475 CTGAGTAAGTGAAATGTTGATGG + Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1127633721 15:60849819-60849841 CAGGGTTGGTGGGATGTGGATGG + Intronic
1127984091 15:64055213-64055235 CTGCGTAAGTGGGTTGGGAATGG - Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1130406047 15:83602870-83602892 CATTGTAAGTGGGCTTTGGAGGG + Intronic
1130728123 15:86462199-86462221 CTCTGTTATTGGGATGTGGTGGG + Intronic
1131234476 15:90683998-90684020 CTTTATAAGTTGGATGTGGGTGG + Intergenic
1131764702 15:95662760-95662782 CTGTGTCAGTGAGATGTCAATGG - Intergenic
1132510461 16:338427-338449 CTGTGTGGGTGGGTTGTGAAAGG - Intronic
1134021352 16:10923563-10923585 CTGAGGCTGTGGGATGTGGATGG - Intronic
1136071197 16:27788298-27788320 GAGTGTAAGAGGGATGAGGAAGG + Exonic
1137290734 16:47050336-47050358 CTTTGGAAGTGGGATGTGGGTGG + Intergenic
1138445462 16:57060496-57060518 GTGTGTATGTGGTATGTGTATGG - Intronic
1140090426 16:71833992-71834014 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1141089648 16:81121485-81121507 CCTTGTAAGTGGGATGGGAAAGG - Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1145924938 17:28639787-28639809 CAGTGTAACTGGGGAGTGGAAGG - Intronic
1147038922 17:37702194-37702216 CTGTTTTAGGTGGATGTGGAAGG + Intronic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1148202422 17:45758115-45758137 CCGTGGAAGTGGAATGTGCAGGG + Intergenic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1149291812 17:55225061-55225083 CTGGGAAGGTGGTATGTGGATGG - Intergenic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151043317 17:70889891-70889913 TTGTGTTTGTGGGATTTGGATGG - Intergenic
1153979095 18:10294247-10294269 CGCTCTAAGAGGGATGTGGAGGG + Intergenic
1155069055 18:22297188-22297210 CTGAGTAAGTAGGCTGTGGTCGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156029773 18:32699087-32699109 CTGTGTAACTGAGATTTGTATGG - Intronic
1156376895 18:36522868-36522890 ATGTTCAAGTGTGATGTGGAGGG + Intronic
1156630474 18:38962345-38962367 CTGTGTATGTGGGATGTCTTTGG - Intergenic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158408234 18:57179400-57179422 GTGTGTAGGTGGGAGGTGGCAGG + Intergenic
1158446473 18:57526534-57526556 CTGAGTCAGTGGGATGGGAAAGG + Intergenic
1159292049 18:66435648-66435670 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164565098 19:29320162-29320184 ATGTGTGTGTGGGATGGGGATGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165388687 19:35526474-35526496 CTTTGTAAGGGAGATGGGGAAGG + Intronic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925156908 2:1655758-1655780 CTGTGTAGGTGGCATGTGTCAGG - Intronic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
929371239 2:41226237-41226259 CTGTGTAAGTTTGCTGAGGATGG - Intergenic
929966408 2:46540755-46540777 GTGTATATGTGGGATGGGGAGGG - Intronic
930294896 2:49542940-49542962 TTGTGTCAGAGGGCTGTGGAAGG - Intergenic
930907858 2:56594688-56594710 CTTTATAAGTGAGATGGGGAGGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933994522 2:87658207-87658229 CTGTGCAGGTAGGGTGTGGAGGG - Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934874400 2:97902733-97902755 CTGAGTCAGTGGGCTGGGGAAGG + Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
940215578 2:151300167-151300189 CTAATTCAGTGGGATGTGGAAGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
946378809 2:219330918-219330940 CTCTTCAACTGGGATGTGGAAGG - Intronic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169797744 20:9482855-9482877 CTGTGTAAAAGGGATTTGGAGGG - Intergenic
1170428585 20:16258487-16258509 GTGTGTATTTGGGATGTGGAAGG - Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173782909 20:45771541-45771563 GCGTGTAAGTGGGGTGAGGAAGG - Intronic
1175666877 20:60868752-60868774 CGGTGTGAGTGGGACGTAGAGGG - Intergenic
1176698027 21:10004498-10004520 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1177003080 21:15637176-15637198 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1177535548 21:22422455-22422477 CTGAGTCAGTGGGCTGTAGAAGG - Intergenic
1178079428 21:29047790-29047812 TTGGGTAAATAGGATGTGGAGGG + Intronic
1178439201 21:32584614-32584636 CGGTGTGAGTGGGATGTGAGTGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1181607311 22:23988502-23988524 GTGTGTGAGTAGGATGTTGAGGG - Intergenic
1181877485 22:25951134-25951156 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1181935977 22:26438966-26438988 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1183062692 22:35345717-35345739 CTGGGTGACTGGGATCTGGAAGG - Exonic
1183582381 22:38733652-38733674 CTGTGATGGTGGGATGGGGATGG + Intronic
1185007993 22:48296149-48296171 CAGTGCAAGTGGTATGTAGAGGG + Intergenic
950141056 3:10615657-10615679 ATGAGCAAGTTGGATGTGGATGG - Intronic
951161956 3:19434379-19434401 CTGTGTAAGGGAGATGAGGGTGG - Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953382811 3:42486867-42486889 CTGTTGAGGTGGGATGTTGAGGG - Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953805688 3:46065595-46065617 CCGTGTAAGTGGGCTGTGTGTGG - Intergenic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954554902 3:51509989-51510011 GTGTGTGTGTGGGATGTGTATGG - Intergenic
956981867 3:74648350-74648372 CTGTGTAACAGGGATGTTGTTGG + Intergenic
957514498 3:81233030-81233052 CTGAGTAAGAGGCATGTTGATGG - Intergenic
958259001 3:91357656-91357678 CTGAGTCAGTGGGCTGGGGAAGG - Intergenic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
958711678 3:97724440-97724462 ATGTGTATGTGGGGTGGGGATGG + Intronic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
962438731 3:135392196-135392218 CTGACTGTGTGGGATGTGGAAGG + Intergenic
962596233 3:136947107-136947129 GTGTGGAAGTGGGGTGTGGTGGG + Intronic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963629855 3:147719605-147719627 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
963630612 3:147725688-147725710 TTGAGTCAGTGGGATGGGGAAGG + Intergenic
963809760 3:149764321-149764343 CTTTGTTGGTGGGCTGTGGAAGG - Intronic
965291662 3:166888962-166888984 TTGGGTAAGAGGTATGTGGATGG - Intergenic
965505447 3:169510220-169510242 CTCTGTGATTGGGATGTGAAGGG + Intronic
966625068 3:182006878-182006900 ATGTGTGTGTGGTATGTGGAGGG + Intergenic
966792381 3:183685468-183685490 CTGTCTTAATGGAATGTGGAGGG + Intergenic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
967505739 3:190250989-190251011 TTGTGTCAGTGGGTTGGGGAGGG - Intergenic
968384287 4:122670-122692 CTGGGTACCTGGAATGTGGATGG + Intergenic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969967072 4:11007990-11008012 CTGTGGAGGTGGCATTTGGATGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971223745 4:24732809-24732831 CCCTGGGAGTGGGATGTGGAGGG - Intergenic
972808371 4:42554817-42554839 TTGAGTAAGTGGGATGGGGAAGG + Intronic
972831677 4:42820998-42821020 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
974950497 4:68579322-68579344 CTCTTTAAGGGTGATGTGGATGG - Intronic
974958884 4:68674841-68674863 CTCTTTAAGGGTGATGTGGATGG - Intergenic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977998272 4:103522973-103522995 CTGTGGATGTGTGATGTTGATGG - Intergenic
978160192 4:105537624-105537646 CTGAGTAAGTGCAATTTGGATGG - Intergenic
978828857 4:113058135-113058157 TTTTGTAAGTAGGATGTGAAAGG - Intronic
979192135 4:117874687-117874709 CTTTGTAAGTGGGAAGTAAAGGG - Intergenic
979546286 4:121944116-121944138 CTGTGTTAGTGGGCTGTGCTGGG - Intronic
980370572 4:131864348-131864370 CTGTGTTAGTTTGATGAGGATGG - Intergenic
981571917 4:146160719-146160741 TTGTGTCAGTGGGCTGGGGAAGG + Intergenic
982551934 4:156813040-156813062 ATGTGTGTGCGGGATGTGGAAGG + Intronic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
984286769 4:177740260-177740282 CAGTGGAAGTGAGTTGTGGAAGG - Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
989486783 5:41999835-41999857 TTGAGTCAGTGGGATGGGGAAGG - Intergenic
990168131 5:53017836-53017858 CAGTGTTGGGGGGATGTGGAGGG + Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992556345 5:77907105-77907127 CTGTGGAAGTGGGATGGCAAAGG + Intergenic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
994006404 5:94842330-94842352 GTGTGTAATTTTGATGTGGAAGG - Intronic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995027218 5:107438291-107438313 CTGTGTAATTGGGATGGCAATGG - Intronic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
997510471 5:134450388-134450410 GTGTGTAAGGGGGATGTAGTGGG + Intergenic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
1000096536 5:157975995-157976017 CTAGGTATGTGGGAGGTGGAGGG + Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001645623 5:173279782-173279804 CTGTGCCAGTGGGCTGTGTAGGG + Intergenic
1002804883 6:563381-563403 CTGTGTAAATGGGAAGGGAATGG - Intronic
1003067992 6:2919600-2919622 CTGGCAAAGTGAGATGTGGAGGG + Intergenic
1003254124 6:4459555-4459577 AAAGGTAAGTGGGATGTGGATGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007085620 6:39142584-39142606 ATAGGTAATTGGGATGTGGAAGG - Intergenic
1007854254 6:44838416-44838438 CTGTGTAAGAGGGCAGTAGAGGG + Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010753581 6:79641576-79641598 TTGTGTAAGTGGGATAGGAATGG + Intronic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011259185 6:85453843-85453865 TTGTCTATGTGGGAGGTGGAGGG - Intronic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012015674 6:93846957-93846979 TTGTGTCAGTGGGCTGGGGAAGG - Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015768532 6:136745054-136745076 CAGTGTAAGTGGTATTTGGCTGG + Intronic
1017225907 6:152021125-152021147 TTGAGTCAGTGGGCTGTGGAAGG + Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018373240 6:163187347-163187369 CTGTGCAAGTGGCCTGTGAAAGG + Intronic
1018822422 6:167383585-167383607 CGGTGTGAGTGGGATGTGAGTGG + Intronic
1021483571 7:21144376-21144398 CTGTGGAGCTGGGATGTTGAGGG + Intergenic
1022540910 7:31134782-31134804 ATGTTTAAATGGGATGAGGAAGG - Intergenic
1022581378 7:31558322-31558344 TTGTCTAACAGGGATGTGGATGG - Intronic
1023314574 7:38921936-38921958 ATGTTTAAGTGGCATGTGGTTGG + Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1023743836 7:43303846-43303868 CTGTGTATGAGGGATGTTGTGGG - Intronic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1024743082 7:52376238-52376260 CTGAGTAAGAGGCGTGTGGATGG + Intergenic
1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG + Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1030276997 7:107732402-107732424 TTGAGTCAGTGGGCTGTGGAAGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031512726 7:122669707-122669729 CAGAGTATGTGTGATGTGGAAGG - Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032263893 7:130357050-130357072 CTGGGTAAGTTAGATGTGGCCGG - Intronic
1032563403 7:132915364-132915386 TTCTGGAAGTGGCATGTGGAGGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG + Intergenic
1037774139 8:21821737-21821759 TTGTGAAAGTGTGAAGTGGACGG - Intergenic
1038446932 8:27611007-27611029 CTGTGGAGGTGGCATGGGGAGGG - Intronic
1042565472 8:70105846-70105868 TTGTGTTAGTGGGATATGGGAGG + Intergenic
1043811353 8:84745220-84745242 TTGTGGAAGTGGGCTTTGGAAGG - Intronic
1045237521 8:100366960-100366982 ATCTGTAAGTGGAATGCGGAGGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046680121 8:117159460-117159482 CTGAGTAAGTGAGATGTCAAGGG - Intronic
1046718959 8:117597417-117597439 CCCTGTAAAGGGGATGTGGATGG - Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1048919350 8:139213707-139213729 CTGGCTTAGAGGGATGTGGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049860528 8:144895210-144895232 GTGTGTAACTTGTATGTGGAAGG - Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1051405018 9:16727630-16727652 CTGTGTTACTGGAATGTGCAGGG - Intronic
1051891601 9:21947863-21947885 TTCTGTCAGTGGGATGTTGAAGG - Intronic
1052442341 9:28512964-28512986 TTGAGTCAGTGGGCTGTGGAAGG - Intronic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1053360489 9:37483112-37483134 CTGTGTAACTGGGATGGGGCAGG - Intergenic
1053412850 9:37926898-37926920 CTGTGTGAGTGGGATCTGCCTGG - Intronic
1053635159 9:39990844-39990866 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1053770772 9:41473467-41473489 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054208728 9:62259854-62259876 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1054316077 9:63588286-63588308 CTGTGTTAGTTTGATGAGGATGG - Intergenic
1054549504 9:66385291-66385313 CTGTGTTAGTTTGATGAGGATGG + Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1057754347 9:97819935-97819957 GTGTGTAGGTGGGACTTGGAAGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1059040869 9:110814199-110814221 CTGTGCAAGTGGTTTATGGAGGG + Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059669005 9:116475878-116475900 GAGTGTAACTGGAATGTGGAAGG - Intronic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1061425480 9:130495702-130495724 TTGAGTAGGTGGGAGGTGGAAGG + Intronic
1062038625 9:134393881-134393903 CTGTATGAGTGGGCTGTGCAAGG + Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1062707381 9:137953064-137953086 CTCTGGGAGTGGGATGTGGTAGG + Intronic
1185650277 X:1642507-1642529 CTGTGTGTGTGTGATGGGGACGG + Intronic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1188765957 X:34090806-34090828 CAGTGTAAGTAGGAAGTGAAGGG + Intergenic
1189681165 X:43518227-43518249 CACTGCAAGTGGGAAGTGGAGGG - Intergenic
1190679683 X:52814349-52814371 CTGTGTTAATAGGATATGGAAGG + Intronic
1190940426 X:55035086-55035108 TTGAGTAAGTGGGCTGGGGAAGG - Intergenic
1192529014 X:71870558-71870580 CTCTGTCCGTGGGGTGTGGAAGG + Intergenic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1193107119 X:77688594-77688616 CTGTGTAAATAGGATTTGGATGG - Intronic
1193870716 X:86794897-86794919 CTGAGAAATTGGGATGTTGATGG + Intronic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1196303505 X:114072921-114072943 CTTTGTAAGTTGGAGGGGGAGGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198472327 X:136959094-136959116 TTGTGTATGTGGGGAGTGGAAGG - Intergenic
1199190216 X:144961994-144962016 AGGTGTATGTGGGATGTGGCAGG + Intergenic
1199423503 X:147675148-147675170 TGGTGAAAGTGGGATGGGGAAGG - Intergenic
1199807714 X:151317237-151317259 CTATGAAAGTGGGGTGAGGATGG + Intergenic