ID: 1017416768

View in Genome Browser
Species Human (GRCh38)
Location 6:154229070-154229092
Sequence GGGGCTGGAGGCAGACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 936
Summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 830}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017416768_1017416787 27 Left 1017416768 6:154229070-154229092 CCCCCATGTCTGCCTCCAGCCCC 0: 1
1: 0
2: 8
3: 97
4: 830
Right 1017416787 6:154229120-154229142 TCTTACTGTATTTAATTATCTGG No data
1017416768_1017416781 -1 Left 1017416768 6:154229070-154229092 CCCCCATGTCTGCCTCCAGCCCC 0: 1
1: 0
2: 8
3: 97
4: 830
Right 1017416781 6:154229092-154229114 CAGGGGCGGCCCTCCCTTACAGG 0: 1
1: 0
2: 0
3: 7
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017416768 Original CRISPR GGGGCTGGAGGCAGACATGG GGG (reversed) Intronic
900135677 1:1116029-1116051 GGGGCTGGGGGCAGGCGTGAGGG - Intronic
900164863 1:1240600-1240622 GTGGCTGGGGGCTGGCATGGGGG - Intergenic
900185795 1:1332608-1332630 GGGTCTGGAGGAGGACGTGGTGG + Exonic
900300470 1:1974367-1974389 GAGGTTGGAGGCAGGCAGGGCGG - Intronic
900407818 1:2500168-2500190 GGGGCAGGGGACAGACATGCTGG - Intronic
900474060 1:2868145-2868167 GGGGCTGCAGGCCGGGATGGTGG - Intergenic
900491485 1:2951460-2951482 GGGGGTGGCAGCAGCCATGGAGG + Intergenic
900506722 1:3032974-3032996 GAGGCTGGAGGAAGGCCTGGAGG + Intergenic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
900612541 1:3550291-3550313 GGTGATGAAGACAGACATGGAGG + Intronic
900651491 1:3732207-3732229 GGGGCTGCAGACAGAGATGAGGG + Intronic
900971229 1:5993301-5993323 GGGGCTGGGGGCAGAATGGGAGG - Intronic
900974784 1:6010305-6010327 GTAACTGGAGGCAGGCATGGTGG + Intronic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901059002 1:6463064-6463086 GTGGCTGGAGGCAGAGTAGGTGG - Exonic
901801252 1:11709336-11709358 GGTGCTGGATGCAGCCATGGAGG + Exonic
901827154 1:11869720-11869742 GGGGCAGGAGGAAGCCAGGGTGG + Intergenic
901936003 1:12627560-12627582 TAGGCAGGAGGCAGGCATGGGGG - Intergenic
902054342 1:13587841-13587863 GGGGCTGGGGTTAGACATGTGGG - Intronic
902079492 1:13811555-13811577 GTGGGTGGAGGCAGCCATGAGGG - Intronic
902756442 1:18552418-18552440 GGGGCAGGAGGAAGACATGATGG - Intergenic
902756656 1:18553372-18553394 GGGACTGGAGGGAGAGCTGGAGG - Intergenic
902757115 1:18556215-18556237 AGGGCTGGAGGCAAGCATAGTGG - Intergenic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
902873963 1:19330117-19330139 GGGTCTGGAGCCAGGCATGGTGG - Intergenic
903013065 1:20343938-20343960 GGGGCTGAAGCCAGAGATGAAGG - Intronic
903332178 1:22601810-22601832 GGGGCTGGCAGCAGGCAGGGCGG + Exonic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
903782294 1:25828474-25828496 GGAGGTGGAGGCAGAGGTGGAGG + Intronic
903963629 1:27072753-27072775 AGGTATGGAGGCAGGCATGGAGG + Intergenic
903963634 1:27072765-27072787 AGGCATGGAGGCAGGCATGGGGG + Intergenic
903963697 1:27072945-27072967 AGGCATGGAGGCAGGCATGGGGG + Intergenic
904197161 1:28794464-28794486 TGGGCAGGGGGCAGCCATGGTGG - Intergenic
904496216 1:30888297-30888319 GGGGCTGGAGGAGCACATGGAGG + Intronic
904615229 1:31745952-31745974 GGGGCTGGTGACTGACGTGGAGG - Intronic
904840561 1:33369384-33369406 GGGGAGGGAGGCAGACAGGCAGG + Intronic
905033204 1:34901156-34901178 GGGGCTGGAGGCGGACATGTGGG + Intronic
905035921 1:34918349-34918371 CAGGGTGGAGGCAGACAAGGGGG + Intronic
905112131 1:35603371-35603393 GGAGCTGCAGAGAGACATGGAGG + Exonic
905139382 1:35829694-35829716 GGGCATGGTGGCAGGCATGGTGG + Intronic
905457087 1:38095802-38095824 GGGGCTGGAAGCAGTGGTGGAGG + Intergenic
905807481 1:40887290-40887312 GGGGGTGGTGGCAGAAATTGGGG + Intergenic
905872768 1:41414674-41414696 GGGGCTGGAGCAGGACAAGGTGG + Intergenic
905915192 1:41679542-41679564 GGGACTGGTGGCAGGGATGGAGG + Intronic
906475773 1:46168497-46168519 AGGGCTGGAGGCAGCCCTGGGGG - Intronic
906634213 1:47397424-47397446 GGGGCTACAGGCAGAGCTGGGGG - Intergenic
907118609 1:51990274-51990296 GGGGCTGGGAGGAGAGATGGGGG - Intronic
907216084 1:52865226-52865248 GGGGAGGGAGCCAGGCATGGTGG - Intronic
907375429 1:54034232-54034254 AGGGCTGGAGGGTGAGATGGGGG + Intronic
907425589 1:54377265-54377287 GGGCCTGGAGGCAGACCTTGTGG - Intronic
907439922 1:54472841-54472863 GGGGCTGGAGGAAGGCATAGGGG - Intergenic
907474774 1:54698464-54698486 GGGGGAGGAGGCAGAAAAGGAGG - Intronic
907541000 1:55215347-55215369 GGGGGAGGAGGCCAACATGGCGG - Intergenic
908925985 1:69255650-69255672 GGGGCTGGAGAGAAACTTGGAGG + Intergenic
909957718 1:81800820-81800842 GGAGCTGGAGGCAGAGCTCGGGG + Intronic
910674149 1:89800257-89800279 AGGGCTGGAGACAGACAGGAGGG + Intronic
911124702 1:94330300-94330322 AGGGCTGGAGGCTGACAGGAAGG - Intergenic
911161041 1:94683577-94683599 GGGGCAGGAGGCTGCCATGGTGG - Intergenic
911694006 1:100867230-100867252 GGGCCTGGAGGTAGAAGTGGGGG - Intergenic
911725601 1:101238276-101238298 GGGGCTGGGGGTGGGCATGGGGG + Intronic
912003948 1:104872036-104872058 GGGGCTTGGGGCGAACATGGGGG + Intergenic
912538723 1:110396432-110396454 GGGGGTAGACTCAGACATGGCGG + Intergenic
913702017 1:121383106-121383128 GGGCTTGGGTGCAGACATGGGGG + Intronic
914042576 1:144063575-144063597 GGGCTTGGGTGCAGACATGGGGG + Intergenic
914092991 1:144520316-144520338 GGATATGGAGGCAGACATGGAGG - Intergenic
914135511 1:144896913-144896935 GGGCTTGGGTGCAGACATGGGGG - Intronic
914646839 1:149660637-149660659 GGAGGTGGAGGCAGAGGTGGAGG + Intergenic
914964091 1:152237708-152237730 GGGGCAGGAGAAAGAGATGGGGG - Intergenic
915004508 1:152623659-152623681 AGGGGAGGAGGCAGACACGGTGG - Intergenic
915101966 1:153507295-153507317 GTGGGAGGAGGGAGACATGGGGG - Intergenic
915164265 1:153939873-153939895 GAGGCTGGAGGTGGAGATGGAGG - Intronic
915291109 1:154883956-154883978 GGGGCTTAAGGCAGAAGTGGGGG + Intergenic
915302257 1:154958458-154958480 GGGGCTGGAGGAAGATCCGGAGG - Exonic
915479130 1:156173211-156173233 GGTGGGGGAGGCAGACAGGGAGG + Intronic
915930438 1:160057582-160057604 GAGGCTGGGGGCAGACAAGAGGG - Intronic
915940606 1:160116129-160116151 TGGGGTGGAGGGAGAGATGGAGG - Intronic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917671843 1:177280685-177280707 TGGGCTGGAGACAGACTTGCAGG + Exonic
917980419 1:180265764-180265786 GGGGATGGAGGTAGGCTTGGAGG + Intronic
918459438 1:184760713-184760735 AGGGCTGGGGCCAGGCATGGTGG - Intergenic
918872457 1:189993018-189993040 GGCTCTGAAAGCAGACATGGCGG + Intergenic
919101894 1:193105713-193105735 GAGGATGGTGGCAGACATGCTGG + Exonic
919752151 1:201044357-201044379 GGAGCTGGAGAGAGCCATGGTGG - Exonic
919790180 1:201285566-201285588 TGGGCTGTAGCCAGAAATGGGGG - Intronic
919816661 1:201445125-201445147 GGGACTGCAGGCAGAAAGGGAGG + Intergenic
919850848 1:201671369-201671391 GGGGCAGGAAGCAGGTATGGAGG - Intronic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
919935523 1:202248198-202248220 GGGGCTGGAAGGCGTCATGGAGG + Intronic
920193664 1:204212020-204212042 TGGGCTGGAGACAGAAATGTGGG - Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920347756 1:205317578-205317600 GGGGCTGGAGGATGGCAAGGAGG - Intronic
920489440 1:206401826-206401848 GGGCTTGGGTGCAGACATGGGGG + Intronic
920526765 1:206672865-206672887 GAGGGTGGAGGCAGGCTTGGAGG - Intronic
920695701 1:208180005-208180027 GGGGCAGGAGGCAGCCAGAGGGG - Intronic
922103407 1:222492456-222492478 AGGGCAGGGGCCAGACATGGTGG + Intergenic
922157459 1:223051572-223051594 GGGCCTGGAAGCTGACTTGGGGG + Intergenic
922731293 1:227949867-227949889 GGTGCTGGAGCCAGACTTTGGGG - Intergenic
922907643 1:229186730-229186752 GGGGCAGGAGGCAGGTAGGGAGG - Intergenic
923127782 1:231047400-231047422 GGGGCTGGAGGTAGGAAAGGAGG - Intergenic
923127800 1:231047473-231047495 GGGGCTGGAGGTAGGAAAGGAGG - Intergenic
923127818 1:231047546-231047568 GGGGCTGGAGGTAGGAAAGGAGG - Intergenic
923127836 1:231047619-231047641 GGGGCTGGAGGTAGGAAAGGAGG - Intergenic
923443404 1:234043132-234043154 GGGGCTGGAGGTAGGGATAGAGG - Intronic
923678809 1:236102642-236102664 GGGGCTGAAAGCAGAAATGTAGG - Intergenic
924261219 1:242233585-242233607 AGGGCTGGCGGCAGGCATGCAGG + Intronic
924470165 1:244336312-244336334 ATGGTTGGAGGCAGCCATGGGGG + Intergenic
1063671299 10:8102125-8102147 AGGGATGGAGGCACACATGCGGG + Intergenic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1064345971 10:14533170-14533192 CGGGCTGCAGGCAGGCAGGGCGG + Intronic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1066278076 10:33888096-33888118 GGGGCTGGAGGAGCACGTGGTGG + Intergenic
1066383272 10:34919662-34919684 CAGGCTGGGGCCAGACATGGTGG + Intergenic
1067237446 10:44462949-44462971 GGGGTGGGAGGCAAATATGGAGG - Intergenic
1067476932 10:46573557-46573579 GGGGCAGGAGTGAGCCATGGAGG + Intergenic
1067538684 10:47136026-47136048 GGGCCAGGAGGCAGAGAAGGTGG - Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067617806 10:47768224-47768246 GGGGCAGGAGTGAGCCATGGAGG - Intergenic
1068008780 10:51421629-51421651 TGTGCAGGAGACAGACATGGAGG - Intronic
1068953902 10:62804969-62804991 CGGGCTGGGGGCAGCCGTGGCGG + Exonic
1069634872 10:69918962-69918984 GGGGTTGGGGGCAGTCAGGGTGG - Intronic
1069635271 10:69921237-69921259 GGAGATGGAGGCAGAGATTGGGG - Intronic
1069748641 10:70731949-70731971 GGGACTGGAGGGAGGCATTGTGG + Intronic
1069949102 10:72007334-72007356 GGGCGTGGAGCCAGCCATGGAGG + Exonic
1070354375 10:75625497-75625519 GGGGTTGGAGGGAGTCAGGGTGG + Intronic
1071417933 10:85458497-85458519 GATGCTGGAGGCAGACTTGCTGG - Intergenic
1071612694 10:87045953-87045975 GGAGCTGGGGCCAGGCATGGTGG - Intergenic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1072971726 10:100023191-100023213 GGCTCTGGAGCCAGGCATGGTGG + Intergenic
1073709269 10:106019707-106019729 GCTGCTGCAGGCAGACATGAGGG + Intergenic
1074686562 10:115967450-115967472 TGGGTGGGAGGCAGACAAGGAGG - Intergenic
1075093683 10:119457459-119457481 AGGGCTGGTGGCAAACATGATGG - Intronic
1075732884 10:124646781-124646803 GAGGCTGGAAGCAGCCATGATGG + Intronic
1075809994 10:125218423-125218445 GGGACAGGAGCCAGCCATGGTGG - Intergenic
1076130091 10:128008182-128008204 GGGGCTGCAGACAGAGATGGTGG - Intronic
1076171696 10:128325285-128325307 GGGGCTGGAAGCATACAGGGTGG + Intergenic
1076215075 10:128686923-128686945 GGTGCAGGAGGCAGACTTGGAGG + Intergenic
1076348747 10:129800124-129800146 GGGGCTGCAGGCAGCTCTGGGGG - Intergenic
1076562366 10:131375513-131375535 GGTGGTCGAGGCAGACATGCCGG + Intergenic
1076680100 10:132167396-132167418 GGCCCTGGGGGCAGACACGGTGG + Intronic
1077035068 11:490516-490538 GGGGCTGGACGAAGACCTGCTGG + Exonic
1077072617 11:682976-682998 GGAGCTGGGGGCAGAAAGGGAGG + Intronic
1077215509 11:1393753-1393775 GAAGCTGGAGGCAGATGTGGAGG + Intronic
1077239180 11:1501774-1501796 GGGGCGGGAGGCAAGCCTGGAGG - Intergenic
1077274348 11:1696672-1696694 GAGGATGGAGGCAGAGACGGGGG + Intergenic
1077403281 11:2369360-2369382 GGGAGTGGAGGCAGAGATGGCGG - Intergenic
1077600319 11:3570120-3570142 GGGACTGGGGGCAGACAAGCGGG + Intergenic
1077607734 11:3623329-3623351 GTGCCTGGAGCCAGGCATGGTGG + Intergenic
1077994915 11:7444844-7444866 GTGGCTGGAGACAGACAAGAGGG + Intronic
1078359914 11:10659993-10660015 GGGTCTCCAGGAAGACATGGAGG + Intronic
1078398836 11:11005550-11005572 GGGCATGGTGGCAGACGTGGAGG + Intergenic
1078422349 11:11222997-11223019 TGGGCTGGGGCCAGACACGGTGG - Intergenic
1078437602 11:11338412-11338434 GGGCCTGAATGCAGACATGAGGG + Intronic
1078465517 11:11547293-11547315 GGGGGTGGAGGCAGCCACAGAGG + Intronic
1078536389 11:12178465-12178487 GGGGTGGGGGGCAGGCATGGGGG + Intronic
1078700036 11:13670811-13670833 GAGGCTGGAGGCAGAGACTGAGG + Intronic
1080888780 11:36390324-36390346 GGTGCTGGTGGAAGACATGAAGG + Intronic
1081411226 11:42760632-42760654 GGGGCGGGGGGCAGGCGTGGGGG - Intergenic
1081651043 11:44824378-44824400 GGGGCTGGGGGCAGGGATAGGGG + Intronic
1081807501 11:45898551-45898573 AGGGCCTGAGGCAGACAGGGTGG + Intronic
1081870826 11:46381811-46381833 GGGGCTGGAGGCGGGGGTGGGGG + Intronic
1082884787 11:58070301-58070323 GATACTGGAGCCAGACATGGTGG - Intronic
1083033427 11:59615244-59615266 GGGACTGTTGGCAGATATGGGGG + Intronic
1083463899 11:62832786-62832808 GGGCCTGGAGGCAGGCAGGCTGG - Intronic
1083597872 11:63927817-63927839 GGGGCTGGGGGCAGTTAGGGAGG - Intergenic
1083766339 11:64843275-64843297 GGTGCTGGAGGCAGTCAGGGAGG + Intronic
1083871018 11:65488546-65488568 CTGGCTGGGGGCAGACAGGGAGG + Intergenic
1083894765 11:65614262-65614284 GGGGCGGGAGGCAGAGGTGGAGG + Intronic
1083956688 11:65987708-65987730 GGGGAAGGAGGCAGACAGGAGGG + Intergenic
1084204601 11:67584314-67584336 GGGGCGGGGAGCAGGCATGGCGG - Intronic
1084323443 11:68385971-68385993 GGGGCTGGCAGGAGACAAGGGGG + Intronic
1084409792 11:69000142-69000164 GGAGCTGGAGGCAGGGATGGGGG - Intergenic
1084517653 11:69645184-69645206 GGGGCATGCGGCAGACAGGGAGG + Intronic
1084755284 11:71234663-71234685 GGGGCTGGGGTCAGGCAAGGTGG - Intronic
1084870705 11:72096967-72096989 GGGGGTGAAGGGAGACATGGCGG - Intronic
1084953834 11:72680970-72680992 TGAGCTGGAGGCAGCCATGGTGG + Intergenic
1085198692 11:74688318-74688340 GGTGGTGGAGGCAGTAATGGTGG - Intergenic
1085300605 11:75456138-75456160 GGGGAAGGAGGCAGACATGCTGG + Intronic
1085302708 11:75467711-75467733 GGGGATGGAGGCTGAGGTGGGGG + Intronic
1085391759 11:76185743-76185765 GGGGCCGAATGCCGACATGGGGG - Intergenic
1085454211 11:76656604-76656626 GGGGCTGGAGACAGAGATGTGGG + Intergenic
1085702133 11:78755003-78755025 GGAGCGGGATGCAGACATGCAGG - Intronic
1085781478 11:79412979-79413001 GGTGCTAGAGGCACCCATGGTGG + Intronic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1088100442 11:106148667-106148689 GGGGCTGGGGGCATGCGTGGGGG - Intergenic
1088504341 11:110513896-110513918 GTGGCTGGAGGCAGGAAGGGTGG - Intergenic
1088647244 11:111926996-111927018 GCGGCTGGAGGCGGAGCTGGAGG + Intergenic
1089210318 11:116796140-116796162 GTGGCTGGATGTGGACATGGTGG - Intergenic
1089528316 11:119110993-119111015 GGGGAGGGAGGCAGAGGTGGGGG + Intronic
1089537295 11:119168734-119168756 GGGGATGGAGGCAGGGAGGGGGG + Intronic
1089650627 11:119910593-119910615 GGGGCTGGAGACACCCAGGGAGG + Intergenic
1089660826 11:119983962-119983984 GAGGCGGGAGGCAGGGATGGAGG - Intergenic
1089824219 11:121258988-121259010 GGGGCTGGAGGCAGGGAGGTGGG - Intergenic
1090606087 11:128424387-128424409 AGGCCTGGAGGCAGACAGGGAGG - Intergenic
1090745722 11:129703416-129703438 AGGGCAGGAGGCAGAAATAGAGG - Intergenic
1091404622 12:201533-201555 GGGGCTGAAGGTGGACATGACGG + Intronic
1092100721 12:5881691-5881713 GGAGCTGGAGGGAGTGATGGGGG - Intronic
1092261795 12:6956814-6956836 GGGCCTGGATGCAGACAGGTGGG - Intronic
1092451632 12:8607708-8607730 GGGACTGGAGGCAGACAGACCGG - Intronic
1093079106 12:14788998-14789020 GGACCAGGAGGCAGACCTGGAGG + Exonic
1093958545 12:25250007-25250029 GGAGGTGGAGGTAGAGATGGTGG - Intronic
1095440584 12:42235782-42235804 GAGGCTTGAGGCCCACATGGGGG - Intronic
1095587076 12:43861177-43861199 GGTCCTGGAGGCAGCCATGTGGG + Intronic
1095828167 12:46552455-46552477 GGGGCTGGAGGCAGGAGTGAGGG - Intergenic
1095943108 12:47739088-47739110 GGGGATGGAGGCAGGAAGGGGGG + Intronic
1096070304 12:48771760-48771782 GGAGCTGGAGGCAAACAATGAGG - Exonic
1096302977 12:50448150-50448172 GGGGCTGGGGCCAGACCTGGTGG - Intronic
1096579799 12:52577528-52577550 AGAGATGGAGGCAGAGATGGCGG + Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1096749038 12:53747263-53747285 GAGGCAGGAGGCAGGCATGATGG + Intergenic
1097021989 12:56027124-56027146 GGGGCTGGAGGAGGTCATGCAGG + Intronic
1097099289 12:56575466-56575488 AGGGCTGGAGGCAGATGGGGTGG + Intronic
1097164902 12:57078739-57078761 GTGGCTTGAGGCAACCATGGCGG - Exonic
1097642412 12:62198322-62198344 GGGGTTGGAGGCAGAAAGAGAGG - Intronic
1100187800 12:92156537-92156559 GAGGCTGAAGGCAGACATTATGG - Intergenic
1100385213 12:94099725-94099747 GGTGGTGGAGGCAGGCAGGGCGG + Intergenic
1102338959 12:112106985-112107007 GAGCCTGGAGCCAGGCATGGTGG + Intronic
1102383038 12:112483761-112483783 CTGACTGGAGGCAGACATGCAGG + Intronic
1102495090 12:113314229-113314251 GTGGGAGGATGCAGACATGGAGG - Intronic
1102496062 12:113320422-113320444 GGGCCTGGAGGCAGCCATGAAGG + Exonic
1102545379 12:113650794-113650816 GGTTCTGGAGGCTGACATGAAGG - Intergenic
1102561110 12:113762874-113762896 GGGGCTGGAGGAAGGCTGGGGGG - Intergenic
1103059558 12:117847702-117847724 GGAGCTGGAGCCAGACAGGTGGG - Intronic
1103410854 12:120710528-120710550 GGGGCTGGTGGCTGGCAAGGAGG + Exonic
1103743497 12:123107028-123107050 GGGGCTGGAGGTGGGGATGGGGG + Intronic
1103948910 12:124541210-124541232 GGGGATGGAGGTGGAGATGGAGG + Intronic
1103949002 12:124541490-124541512 GGGGATGGAGGAGGAGATGGAGG + Intronic
1104109095 12:125688952-125688974 GGGGCAAGAGGCACCCATGGGGG - Intergenic
1104682369 12:130760732-130760754 TGGGGTGGAGGCAGACCTGGAGG - Intergenic
1104729079 12:131095100-131095122 GGGACTGAAGGGAGAGATGGGGG - Intronic
1104729272 12:131096035-131096057 GGGCCGGGAGGCAGGAATGGTGG - Intronic
1104769495 12:131352250-131352272 GGAGCTGCAGGGAGACCTGGTGG - Intergenic
1104832178 12:131760784-131760806 GTTGCTGGGGCCAGACATGGTGG + Intronic
1105557409 13:21459529-21459551 GGGGCTGGATGCGGACAGGCTGG + Intergenic
1106229433 13:27810334-27810356 AGAGCTGGAAGCACACATGGTGG + Intergenic
1108179007 13:47822491-47822513 GGAGCTGGAGGCATCCATGTGGG - Intergenic
1108495873 13:51024938-51024960 TGGGATGGAGACATACATGGTGG + Intergenic
1109756775 13:66771327-66771349 GGGGCTGAAGGGAGGAATGGAGG - Intronic
1109982885 13:69933717-69933739 TAGGCTGGAGGCAGAGACGGTGG - Intronic
1111425502 13:88075289-88075311 GGGGCTGGAGGCAACGTTGGAGG + Intergenic
1111986069 13:95068199-95068221 GGGGCTGCAGGCAGGTGTGGAGG + Intronic
1113294858 13:108947667-108947689 GGGGGTGGAGACAGACAGGGTGG - Intronic
1113458039 13:110462830-110462852 GGCGCGGGAGGCAGCCATGGAGG + Intronic
1113518288 13:110919798-110919820 GAAGATGGAGGCAGAGATGGGGG + Intergenic
1113653474 13:112054168-112054190 GGGGCTGGAGGCAGCTACGTGGG + Intergenic
1113730435 13:112637500-112637522 GGGCCTGGAGGCCGCCCTGGCGG - Intergenic
1113946664 13:114048395-114048417 GGGGCTGGAGGGGCAAATGGAGG + Intronic
1114533828 14:23410948-23410970 GGGGCTGGATGCAGACAGCAGGG - Intergenic
1115518168 14:34206062-34206084 GGTGCTGGAGGTGGAGATGGAGG - Intronic
1115662681 14:35512475-35512497 GCAGCTGGAGACAGAGATGGAGG - Intergenic
1116573670 14:46547545-46547567 GCGGCTGCACGCAGACATGAGGG - Intergenic
1117208774 14:53473321-53473343 GGGACTAGAGGTAGACATAGTGG + Intergenic
1117435693 14:55713324-55713346 GGGGCTGGAGGAAAGCATGAAGG + Intergenic
1118331220 14:64817502-64817524 GTACCTGGAGACAGACATGGGGG + Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1118827447 14:69397348-69397370 GGGGCTGGAGGCTGAAAAGTAGG - Intronic
1119266455 14:73265531-73265553 GGGGCTGGAGGCAGAATAGGAGG - Intronic
1119641060 14:76315247-76315269 GGGGGTGAATGCAGTCATGGAGG - Intronic
1119665778 14:76484141-76484163 GGGCCTTGGGCCAGACATGGTGG - Intronic
1119711196 14:76823633-76823655 GTGGCTGGGGTCAGGCATGGTGG + Intronic
1119916276 14:78405264-78405286 GGGGATTGAGTCATACATGGAGG + Intronic
1120490925 14:85177658-85177680 GGGGCAATAGGCAGACATGCAGG - Intergenic
1120664599 14:87291202-87291224 GGGGAGGGAGGGAGAGATGGAGG - Intergenic
1120800195 14:88679402-88679424 GGGGCTATAGCCAGGCATGGTGG + Intronic
1122057909 14:99117628-99117650 AGGGCTGGCGGCAGGGATGGGGG - Intergenic
1122357789 14:101134346-101134368 GGGTGCGGAGGCAAACATGGAGG + Intergenic
1122359497 14:101151113-101151135 GGTGCTGCAGTCAGCCATGGGGG - Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122544481 14:102514628-102514650 GGGGCTGGCACCAGACATGCTGG + Intergenic
1122631423 14:103109312-103109334 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631437 14:103109348-103109370 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631451 14:103109384-103109406 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631465 14:103109420-103109442 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631479 14:103109456-103109478 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631493 14:103109492-103109514 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631521 14:103109565-103109587 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631535 14:103109601-103109623 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631549 14:103109637-103109659 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631563 14:103109673-103109695 AGGGAGGGAGGGAGACATGGGGG - Intronic
1122689424 14:103524739-103524761 GCCCCTGGAGGCAGACTTGGGGG + Intergenic
1122983872 14:105203440-105203462 GGGCCTGGGGCCAGAAATGGGGG - Intergenic
1123665576 15:22607799-22607821 GGGGCTGCAGACAAGCATGGTGG - Intergenic
1123752180 15:23364853-23364875 GGGGCTGCAGACAAGCATGGTGG + Exonic
1123948013 15:25248250-25248272 GGTGCTGCAGGCAGCCCTGGGGG + Intergenic
1124319405 15:28702213-28702235 GGGGCTGCAGACAAGCATGGTGG - Exonic
1124362678 15:29049631-29049653 TGAGCTGGAGGCAGTCAGGGTGG - Intronic
1124426718 15:29569839-29569861 GGGGCAGGGGGCAGGCAAGGGGG - Intronic
1124489561 15:30145286-30145308 GGGGCTGCAGACAAGCATGGTGG + Exonic
1124520470 15:30404000-30404022 GGGGCTGCAGACAAGCATGGTGG - Exonic
1124538187 15:30562219-30562241 GGGGCTGCAGACAAGCATGGTGG + Exonic
1124544653 15:30614280-30614302 GGGGCTGCAGACAAGCATGGTGG + Exonic
1124564611 15:30801709-30801731 GGGGCTGCAGGCAAGCATGGTGG + Intergenic
1124568773 15:30840241-30840263 GGAGCTGTAGGCATACTTGGAGG + Intergenic
1124753966 15:32393041-32393063 GGGGCTGCAGACAAGCATGGTGG - Exonic
1124760466 15:32445366-32445388 GGGGCTGCAGACAAGCATGGTGG - Exonic
1124778170 15:32603696-32603718 GGGGCTGCAGACAAGCATGGTGG + Exonic
1124993407 15:34698309-34698331 TGGGTTGGAGGCAGACATGTGGG - Intergenic
1125045994 15:35242404-35242426 GCCGCTGCAGGCAGACATGAGGG - Intronic
1125084823 15:35717489-35717511 GGGGCTGGAGGGAGATCTGTGGG + Intergenic
1125479589 15:40070789-40070811 TGGCCTGGAGCCAGGCATGGTGG + Intergenic
1125510249 15:40288855-40288877 GGGTCTGGAGGCAGAGGTGAAGG - Exonic
1126599879 15:50417955-50417977 GGGACTGGTGGCAGCCATAGAGG - Intergenic
1127055795 15:55129875-55129897 AGAGTTGGAGGCAGACATAGAGG - Intergenic
1127396285 15:58546227-58546249 GGGGCTGGAGTGAGAAGTGGAGG - Intronic
1127850903 15:62910847-62910869 GGGGAAGGAGGCAGACATGCAGG - Intergenic
1128133863 15:65248702-65248724 GGGGAAGGAGGCAGACAGTGTGG - Intronic
1128145484 15:65330394-65330416 GGGTCTGGAGGAAGGCAGGGCGG + Exonic
1128145568 15:65330738-65330760 GGGGCTGCAGGTAGAGAAGGAGG + Exonic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128255830 15:66195894-66195916 GGGGCTGGAGTAAGACGTGGTGG + Intronic
1128353954 15:66911431-66911453 GAGGCTGGAGCCAGGCCTGGAGG - Intergenic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129405344 15:75313308-75313330 GGGGCTGGAGGAAGACCTCATGG - Intergenic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1129749236 15:78049016-78049038 GGAGTTGGAGGAAGACAGGGTGG + Intronic
1129754914 15:78092381-78092403 TTGGCTGGCTGCAGACATGGGGG - Intronic
1130151204 15:81313074-81313096 GGGGCAGGAGGCAGGAAGGGTGG + Exonic
1130752689 15:86729301-86729323 GGGTCAGGAGGCACACATGCAGG + Intronic
1131114320 15:89784703-89784725 AGTCCTGCAGGCAGACATGGAGG + Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132019914 15:98351899-98351921 CAGGCTGGTGGCAGATATGGAGG + Intergenic
1132338351 15:101063099-101063121 TTGGCGGGAGGCAGAGATGGAGG - Intronic
1132396418 15:101478308-101478330 GTGGCTGGCGGCAGTCATGGTGG + Intronic
1132599854 16:768586-768608 AGGGCTGGGGGCAGAGCTGGGGG + Intronic
1132810703 16:1795315-1795337 GGGGGTGGCGGCAGTGATGGGGG - Intergenic
1132842289 16:1984070-1984092 GGGGCTGGGGGCAGAGTCGGGGG - Intronic
1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG + Intronic
1133003019 16:2860618-2860640 TGGGCGGGAGGCAGAGAGGGAGG - Intergenic
1133035340 16:3031054-3031076 GGAGCTGGAGGGGGACGTGGAGG - Exonic
1133559035 16:6932896-6932918 GGGGCTGGGGGAAGACATAATGG - Intronic
1133908218 16:10040819-10040841 GAGGCTGGAGGCAGCTGTGGGGG + Intronic
1134404175 16:13940625-13940647 GGAGCTGTAGCCAGCCATGGAGG - Intronic
1135051330 16:19195426-19195448 GGGAGTGGGGGCAGGCATGGTGG + Intronic
1135078613 16:19415064-19415086 GTGGCTGGAGATAGATATGGAGG - Intronic
1135135305 16:19882813-19882835 GGAGCTGTAGGCAGATTTGGGGG - Intronic
1135534627 16:23283807-23283829 AGGGCTGGAGGGACACAGGGAGG + Intronic
1135771426 16:25221150-25221172 AGGGCTGGAGGGAGGCTTGGAGG + Intronic
1135912059 16:26570515-26570537 GTGGGTGGAGGGAGAGATGGTGG - Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136922429 16:34344031-34344053 GGGGATGGAGCCAGAGAGGGAGG - Intergenic
1136982144 16:35067775-35067797 GGGGATGGAGCCAGAGAGGGAGG + Intergenic
1137589886 16:49687043-49687065 TGGGGAGGTGGCAGACATGGAGG - Intronic
1137811081 16:51353118-51353140 GGGGTTGAAGGCAGATATGTTGG - Intergenic
1138387338 16:56644617-56644639 GGGGCTGGAGGCACAGCTTGAGG + Intronic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138458431 16:57134171-57134193 GGGCCTGGAGGCAGAGAAGCAGG + Intronic
1138510817 16:57507620-57507642 GGGGCTTGAGGAAGACTGGGAGG + Intergenic
1138528941 16:57624675-57624697 GGGGGAGTAGGAAGACATGGTGG - Intronic
1138539753 16:57680637-57680659 AGGGCGGGAGGGAGACATGGTGG - Intronic
1138635064 16:58331629-58331651 GGGGGTGGAGCCAGACAGGAAGG - Intronic
1139225697 16:65231908-65231930 GCCGCTGCAGGCAGACATGAGGG + Intergenic
1139434546 16:66928491-66928513 GGGGATGAAGGGAGTCATGGGGG - Intergenic
1139440938 16:66966478-66966500 GGGCTTGGAGACAGAAATGGAGG + Intronic
1141006707 16:80359342-80359364 GGGGCTGGAAGTAGAAAGGGAGG + Intergenic
1141154522 16:81587930-81587952 GGGGCTGCAGGCTTCCATGGAGG - Intronic
1141205003 16:81926710-81926732 GGTTCTGGAGGCAGACAGGCTGG - Intronic
1141585943 16:85033661-85033683 GGGGGTGGGGGCAGGGATGGGGG + Intronic
1141630275 16:85283923-85283945 TGGGCAGGAGGGAGACGTGGTGG - Intergenic
1141698715 16:85632755-85632777 GGCGCTGGGGCCACACATGGTGG - Intronic
1141722678 16:85765572-85765594 GGGGGTGGGGGCAGAGGTGGGGG + Intergenic
1141809849 16:86368530-86368552 GATGATGGAGGCAGACACGGAGG - Intergenic
1141832198 16:86516020-86516042 GGGGCGGGAGGCACCCAGGGGGG + Intergenic
1141982903 16:87560982-87561004 GGGGCTGGAGCTAGGCCTGGAGG + Intergenic
1142141496 16:88474666-88474688 GGGGCTGGCTTCAGACAGGGTGG - Intronic
1142235700 16:88921545-88921567 GGGGCTGCAGACAGAGAGGGAGG - Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356367 16:89603797-89603819 GGGGCTGGAGGAAGCACTGGGGG + Intergenic
1143026114 17:3942872-3942894 GGGGCTGGAGAGGGAAATGGAGG - Intronic
1143073133 17:4315198-4315220 GGGGCTGGGGGAGTACATGGAGG + Intronic
1143388282 17:6545068-6545090 GGGGCTGGAAGCAGTCAGGTGGG - Intronic
1143414989 17:6740510-6740532 AAGGCTGGATGCAAACATGGAGG - Intergenic
1143509657 17:7388510-7388532 GGGCGTGGAGGCAGGCCTGGAGG - Exonic
1143635822 17:8163200-8163222 GGGGCTGTGGTCAGACAGGGTGG - Intronic
1144498500 17:15765377-15765399 GGGCATGGTGGCAAACATGGAGG + Intergenic
1144738508 17:17568269-17568291 GGGGCTGGAGGAGGTGATGGTGG - Intronic
1145161882 17:20580418-20580440 GGGCATGGTGGCAAACATGGAGG + Exonic
1145282583 17:21478526-21478548 GGGTCTGGAGGCAGAGAGGCAGG - Intergenic
1145394896 17:22487229-22487251 GGGTCTGGAGGCAGAGAGGGAGG + Intergenic
1145997116 17:29111223-29111245 GAGGTGGGAGGCAGACATGGTGG - Intronic
1146003938 17:29149089-29149111 GGGCCTGGAGGCCGGCCTGGCGG - Intronic
1146038255 17:29427082-29427104 GGATTTGTAGGCAGACATGGGGG + Intronic
1146185459 17:30721370-30721392 GAGGAGGGAGGCAGAGATGGGGG - Intergenic
1146185991 17:30724570-30724592 ATGGCTGGAGGGAGACAAGGCGG + Intergenic
1146382767 17:32343214-32343236 GAGGCTGGAAGTTGACATGGAGG - Intronic
1147257643 17:39191672-39191694 GGGGCTCGAGGCATCCATGATGG - Intronic
1147265410 17:39231625-39231647 GGGGCTGACAGCAGCCATGGTGG + Intergenic
1147570426 17:41567382-41567404 GGAAGTGGAGGCAGCCATGGTGG - Exonic
1147652320 17:42069628-42069650 GTGGCTGTTGGCTGACATGGAGG - Intergenic
1147845251 17:43400053-43400075 GCGGCTGGAGGAAGCCAAGGTGG + Exonic
1147965248 17:44191202-44191224 GGTGCTGGGGGCAGACATGCAGG - Exonic
1148055233 17:44790429-44790451 GAGGCTGGAGCCAGACGCGGTGG + Intergenic
1148148947 17:45384814-45384836 GGGGCAGGAGGCAGAGAATGGGG + Intergenic
1148716857 17:49722176-49722198 GAGACTGGAGGAAGACAGGGAGG - Intronic
1148734570 17:49858245-49858267 GGGGCTGGAGGCAGAGACATTGG + Intergenic
1148797363 17:50203437-50203459 AGGGCTGGAGACAGCAATGGAGG + Intergenic
1149269112 17:54957136-54957158 GGGGCTGGAAGCAGATAGGAGGG - Intronic
1149449475 17:56738515-56738537 GGTGCAGGAGAAAGACATGGAGG + Intergenic
1149571275 17:57674085-57674107 GGGGATGGAGGGAGGGATGGGGG - Intronic
1149575066 17:57706012-57706034 GAGGCTGGAGGCAGAAACTGGGG + Intergenic
1150112822 17:62517190-62517212 GGTGCTGGAGGCTGGCATGGTGG - Intronic
1150649609 17:67001321-67001343 GGAGCTGGAGGGAGCCATGTGGG - Intronic
1151281982 17:73083107-73083129 TGGTCTTCAGGCAGACATGGAGG - Intronic
1151464644 17:74276641-74276663 GTGTCTGGAGGCAGACAGAGGGG - Intronic
1151471769 17:74322809-74322831 GGGGCTGGGGCCAGGCACGGTGG + Intergenic
1151576587 17:74955542-74955564 GGGGATGGAGGCAGGGAAGGAGG - Intronic
1151675608 17:75595859-75595881 GGGGCTGGAGGGAGAGGAGGTGG + Intergenic
1151699511 17:75735866-75735888 TAGGATGGAGGCAGAGATGGAGG + Intronic
1152100081 17:78296261-78296283 GGGCCTGGAGCCAGGCAGGGAGG + Intergenic
1152258665 17:79254881-79254903 GGGGCTTCAGGCTGACATGCTGG + Intronic
1152280705 17:79383562-79383584 GGGGCAGGAGGCAGCCATCGGGG - Intronic
1152287899 17:79423076-79423098 GGGGCTGGAGGCAGAAAGAGGGG - Intronic
1152343368 17:79737498-79737520 GGGGCTGGAGGGAGCGAGGGTGG + Intronic
1152408852 17:80112010-80112032 GTGGCTGGAGGCACAGATGGTGG - Intergenic
1152577480 17:81149250-81149272 GGGGCTGGAGGCTGTGGTGGTGG - Intronic
1152703334 17:81830347-81830369 GGGGCTGGGGCCAGGCGTGGTGG + Intronic
1152812198 17:82387229-82387251 GGGGCTGGGAGCAGACAGGAAGG + Intergenic
1152892748 17:82891767-82891789 GGGGCTGGGGGCAGAGACGAGGG + Intronic
1153515341 18:5895960-5895982 GGGGAGGGAGGCAGGCACGGAGG - Intergenic
1153923411 18:9811302-9811324 GGGACTGGAGGCAGGGAGGGTGG + Intronic
1155029171 18:21969237-21969259 GGGGCCTGAGGCGGGCATGGTGG + Intergenic
1155453415 18:25986513-25986535 TGAGCTGGAGGCAGACATTTGGG - Intergenic
1155507587 18:26548266-26548288 GGGGCTGGAGGAGGACGAGGAGG - Intronic
1155835339 18:30575084-30575106 CAGGATGGAGCCAGACATGGTGG - Intergenic
1156469268 18:37367314-37367336 CAGACTGGAGGCAGACACGGGGG + Intronic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156892959 18:42210918-42210940 TAGGCTGGATGCAGACAGGGAGG - Intergenic
1157284505 18:46368338-46368360 GGGGGTGGAGGCAGAAAGGGAGG - Intronic
1157480433 18:48050324-48050346 GAGGCTGGAACCAGACATGTGGG + Intronic
1157674987 18:49562174-49562196 GGGACTGGAGGCAGAGAAGGTGG - Exonic
1158571224 18:58598383-58598405 GAGCCTGGAGGCAGACGGGGAGG + Intronic
1158638840 18:59184996-59185018 AGGGCTAGGGCCAGACATGGTGG + Intergenic
1159000594 18:62971539-62971561 GGGGCTGAAGGAGGACAAGGTGG - Intronic
1160225362 18:77007473-77007495 GGGGCTGGAGGGAGAAGTTGAGG + Intronic
1160487980 18:79310861-79310883 TGGGCTGGGGCCAGGCATGGTGG + Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160776578 19:859409-859431 TGGGCAGGAGGCAGAGAGGGGGG - Intergenic
1160826096 19:1081259-1081281 GAGGCAGGGGGCAGACCTGGAGG + Intronic
1160863179 19:1246111-1246133 GGAGCAGGAGGCAGTCAGGGTGG + Intergenic
1160880412 19:1317071-1317093 TGGGCTGGATGCGGACACGGTGG + Intergenic
1160904869 19:1447263-1447285 GGGGCTAGAGGCAGAAACAGGGG - Intronic
1160946978 19:1648240-1648262 GGGGCAGAAGGCAGGCATGCAGG + Intronic
1161034973 19:2079490-2079512 GAGGATGCAGGCAGAGATGGGGG + Intronic
1161152701 19:2717940-2717962 GGGGAGGGAGGAGGACATGGCGG + Intronic
1161306894 19:3573492-3573514 GGGACTGGAGGCCGAGGTGGGGG - Intronic
1161333249 19:3698178-3698200 GGGCCTGGAGGCACCGATGGTGG + Intronic
1161409871 19:4111124-4111146 GGGGCTGGAGGAGGGGATGGGGG + Intronic
1161429683 19:4224368-4224390 GGGACTTGGGGCAGCCATGGAGG + Intronic
1161717893 19:5887070-5887092 GGGGCTGGAGCCAGGCATGGTGG - Intronic
1161740646 19:6019001-6019023 GCGGCAGGAGGCAGACTTTGTGG - Intronic
1161911365 19:7197065-7197087 GGGGTTGGGGGCAGCCAAGGAGG + Intronic
1162055004 19:8057305-8057327 TGAGCTGGAGCCAGGCATGGTGG - Intronic
1162300974 19:9844788-9844810 GGGGCTCGAAGCAGAAATGCTGG - Intronic
1162302001 19:9849532-9849554 GGTGCTGGAGGCAGACTCGAGGG + Exonic
1162423271 19:10578327-10578349 GGAGATGGAGGCAGGCGTGGCGG + Intronic
1162584343 19:11549882-11549904 GGGGCTGGAGGATGCCATGCAGG - Exonic
1162706409 19:12558324-12558346 GGGGCTGGGGCCAGGCACGGTGG + Intronic
1162789220 19:13054445-13054467 GGGGCTGGAGGTGGGCTTGGTGG + Intronic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1162972786 19:14191161-14191183 ATGGCTGGAGGGAGACAAGGCGG - Intronic
1162973317 19:14194326-14194348 GAGGAGGGAGGCAGAGATGGGGG + Intronic
1162983869 19:14256737-14256759 GGGTCTTGTGGCAGACGTGGTGG + Intergenic
1163162451 19:15472608-15472630 GGAGGTGGGGGCAGGCATGGTGG + Intronic
1163517717 19:17775031-17775053 GGGGATGGAGGAAGAGATGTTGG - Intronic
1163574310 19:18101599-18101621 GGGGTTGGAGGCACACAGAGAGG - Intronic
1163610195 19:18296758-18296780 GGGGATAGAGGCAGACATTAAGG - Intergenic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1163719922 19:18894124-18894146 GGGGCTGGAGGCAGAAAAAGGGG + Intronic
1165229965 19:34380804-34380826 GGCACTGGAGGCAGAGATGTGGG - Intronic
1165250899 19:34533246-34533268 GGGGCTAGAGGCAGAGAGGAAGG - Intergenic
1165380011 19:35472569-35472591 GGGGCAAGAGGCAGGAATGGAGG - Intergenic
1166105741 19:40597302-40597324 GGGGCTGGCGGCGGAGGTGGCGG - Exonic
1166277267 19:41762710-41762732 GGTGCTGGGAGCAGAGATGGGGG - Intronic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1166667931 19:44692434-44692456 AGGGCTGTAGGCAGACCCGGGGG - Intergenic
1166874822 19:45890882-45890904 GGGGGTGGGGGCAGAGGTGGAGG + Exonic
1167574281 19:50310303-50310325 AGGGGTGGACGCAGAAATGGGGG - Exonic
1167690531 19:50981911-50981933 TGGGCTGGATGGAGACATGGAGG + Exonic
1167781862 19:51603580-51603602 GGGGCTGGAGACAGAAATCATGG + Intergenic
1167799055 19:51728543-51728565 GGGGATGGACACAGACATGGCGG + Intergenic
1168064277 19:53910190-53910212 TGGGATGGAGGCAGCCAGGGTGG + Intronic
1168064557 19:53911653-53911675 TGGGATGGAGGCAGCCAGGGTGG + Intronic
1168421671 19:56208114-56208136 GGACCTGGAGGAAGACAGGGAGG + Exonic
1168431840 19:56287663-56287685 GGGGGTTGAGGCAGATGTGGAGG + Intronic
1168464236 19:56589282-56589304 GGGGCTGGAGGCTGACCTCTGGG - Intergenic
1168507327 19:56947293-56947315 GGGGCAGGAGGAAGAGATGGGGG + Intergenic
925047232 2:781884-781906 GGGGATGAAGGCAGACACTGGGG - Intergenic
925057560 2:866866-866888 AGGGCTGGAGGCAGAGAGGAAGG - Intergenic
926166478 2:10524414-10524436 AGGGCTGAGGGCAGCCATGGTGG + Intergenic
926188344 2:10708872-10708894 GTGGTGGGAGGCAGGCATGGGGG + Intergenic
926323302 2:11763856-11763878 GGCGCTGGAGGCGGGCTTGGAGG - Intronic
926843497 2:17107893-17107915 GGGGCTGGAGAAAGAGATGTGGG + Intergenic
927435508 2:23063038-23063060 GGGGCATTAGGCAGAAATGGGGG - Intergenic
928434323 2:31244343-31244365 GGTGATGCAGGGAGACATGGAGG + Exonic
929277971 2:40045744-40045766 GTAGCTGGAGGGAGAAATGGAGG - Intergenic
929564381 2:42975438-42975460 AGGGCTGGAGGAAGACAGGAAGG - Intergenic
929586012 2:43114925-43114947 GGTGCTCGAGGCTGCCATGGGGG - Intergenic
929668208 2:43850069-43850091 GGGTGTGGTGGCAGGCATGGTGG + Intronic
929808493 2:45169306-45169328 GGCGCTGGAGGCCGACGGGGAGG + Intergenic
929963584 2:46515546-46515568 GGGGTTGGGGGCAGGTATGGGGG + Intronic
930019877 2:46995052-46995074 GGGGCAGAAGGCTGGCATGGTGG + Intronic
930027108 2:47035743-47035765 GGGGCTGGAGGCAGGAATTGTGG + Intronic
930671193 2:54152552-54152574 GGGGCTAGAGGGAGAGAAGGAGG - Intronic
931220802 2:60286295-60286317 GGGGGAGGAGGGAGACATGTAGG - Intergenic
931732490 2:65165501-65165523 GGGGTGGGAGGCAGGCTTGGAGG + Intergenic
932326166 2:70863281-70863303 GAGGCTGGAATCAGACACGGAGG - Intergenic
932363523 2:71130283-71130305 GGGGCGGGAGGCAGAGGGGGCGG + Intergenic
932430281 2:71670118-71670140 AGGGGTGGATGCAGAGATGGTGG - Intronic
932438259 2:71715911-71715933 GAGGCTGAAGGCAGGAATGGTGG + Intergenic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932742960 2:74306009-74306031 GGGGTTGGAGCCAGGCACGGTGG - Intronic
933747079 2:85579188-85579210 GGGGCTGGAGGAAAACAGGGAGG + Intronic
933752421 2:85611635-85611657 CGGGCTGGAGGCAGGCGGGGCGG + Intronic
935184875 2:100722937-100722959 GGAGTTGGGGGCAGACGTGGAGG - Intergenic
935390850 2:102551214-102551236 GGGTCAGGAGGCAGAGAAGGTGG + Intergenic
935459026 2:103306832-103306854 GGACCTGGAGCCAGACACGGTGG - Intergenic
935660958 2:105466443-105466465 GTGGCTGGAAGCAGAAATGGGGG + Intergenic
935735153 2:106100594-106100616 GGGGCTGTGGGCAGGCATGCAGG + Intronic
936004626 2:108872680-108872702 GGGGCTGCACTCACACATGGCGG + Intronic
936976261 2:118224830-118224852 GGGGCTGGAAGCGAAGATGGGGG - Intergenic
937321611 2:120964279-120964301 GGGGCTGGAAGGAGACCTGGTGG + Intronic
937460001 2:122077413-122077435 GGGACAGGAGGCAGAGAAGGTGG - Intergenic
937770919 2:125720515-125720537 GAGGCAGGAGGCAGAGATAGAGG + Intergenic
937936436 2:127249281-127249303 GGACCAGGAGGCAGACCTGGAGG - Intergenic
938227517 2:129628498-129628520 AGGGCTGGAGGCAGGGCTGGAGG + Intergenic
938841398 2:135168324-135168346 CGGGCTGGAGACAGACAGGAGGG - Intronic
939162283 2:138604768-138604790 GGAGGAGGAGGCAGGCATGGTGG + Intergenic
939166422 2:138645837-138645859 GGGTATGGAGACAGACATGAAGG + Intergenic
940145762 2:150542658-150542680 GGGGCGGGACTCAGGCATGGCGG + Intergenic
942940051 2:181606268-181606290 GGGGTGGGAGGAAGACAGGGAGG + Intronic
944547295 2:200811483-200811505 GAGGCTGGGGGCGGGCATGGGGG - Intronic
945744673 2:213705477-213705499 GGAGCTGGAGGTAGAAAGGGTGG + Intronic
946173895 2:217911090-217911112 GTGGGTGGAGACAGACATAGGGG - Intronic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
948088213 2:235267964-235267986 GGGGCTGGAGGCAGGCTGGTGGG - Intergenic
948422133 2:237866145-237866167 GGGCCTGGATGCAGACGTGGGGG - Intronic
948467512 2:238159262-238159284 GCGGCGGGAGGCGGACGTGGAGG + Intronic
948566118 2:238887537-238887559 GGCACTGGAGGCAGACTTGGTGG + Intronic
948695301 2:239730128-239730150 GGTGCAGGAGGCAGGCTTGGAGG + Intergenic
948709195 2:239814980-239815002 GGAGCCGCAGGCAGACATGCGGG - Intergenic
948846265 2:240684147-240684169 GGTGCTGGAGTCAGTCCTGGGGG - Intergenic
948892895 2:240915839-240915861 GGGGCAGGAGGAAGAGATAGGGG + Intergenic
948921296 2:241067141-241067163 GGGGCTCCAGCCAGCCATGGTGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
949035989 2:241815977-241815999 GGGGCTGGAGGAAGGCACAGGGG - Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1168827723 20:825094-825116 TGAGCTGGAGGCAGTGATGGTGG + Intergenic
1168953469 20:1818167-1818189 GGGGAGAGAGGCTGACATGGAGG - Intergenic
1168978204 20:1983681-1983703 GGAACTGGAGGCAGGCAGGGAGG - Intronic
1169260478 20:4134705-4134727 GTCGCTGGAGGCAGATAAGGAGG + Intronic
1169263941 20:4156463-4156485 AGGTGGGGAGGCAGACATGGGGG - Intronic
1169927605 20:10799162-10799184 GGGGCTGGGGGATGACAGGGTGG + Intergenic
1169941067 20:10938147-10938169 GGGTCTGTGGGCAGTCATGGAGG + Intergenic
1170353671 20:15469561-15469583 GGGGCTGGAAGCAGAGGAGGGGG + Intronic
1171373429 20:24676101-24676123 AGGGCTGTAGGCAGGCAGGGTGG - Intergenic
1172308586 20:33899640-33899662 CTGGCTGGGGGCTGACATGGAGG + Intergenic
1172445317 20:34990339-34990361 GGGGCTGGAGGCTGCCAAGAGGG - Intronic
1172630899 20:36377642-36377664 GGAGCTGGAGACAGAGACGGTGG - Intronic
1173155415 20:40604481-40604503 GGGGCTGGAGGTTGGCATGCAGG + Intergenic
1173565145 20:44033181-44033203 GGGGCCAGAGGCAGGCACGGGGG + Intronic
1173585177 20:44176915-44176937 AGAGCTGGAGTCACACATGGAGG - Intronic
1173916970 20:46714914-46714936 GGTGCAGGAGGCAGAGGTGGAGG - Intronic
1174378499 20:50141694-50141716 GGGGCTTGAGGCAGAGAGGCTGG + Intronic
1174397034 20:50253094-50253116 GGGCCAGGAAGGAGACATGGAGG + Intergenic
1175119451 20:56706998-56707020 GGGGCTGGACTCAGACCAGGAGG - Intergenic
1175136631 20:56829208-56829230 GTGGCTGGATGCAGAAAAGGGGG - Intergenic
1175398517 20:58685006-58685028 GGGGCTGGGGCCAGGCATGGTGG - Intronic
1175483934 20:59331277-59331299 GGGGCTGGACCCAGACCAGGAGG - Intergenic
1175634179 20:60566771-60566793 GGGGCTGGATTCAGCCATAGGGG + Intergenic
1175821810 20:61914078-61914100 GGGGCAGGAGGCACAGGTGGTGG - Intronic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1175997466 20:62817995-62818017 GGCTCTGGAGCCAGCCATGGAGG + Intronic
1176026201 20:62986723-62986745 GTGGCTGGAGTCTGACATGGGGG + Intergenic
1176107354 20:63395679-63395701 GGGGCTGGAGGTGGACTGGGAGG + Intergenic
1176150780 20:63589660-63589682 CTGGCTGGGTGCAGACATGGGGG + Exonic
1176307974 21:5134254-5134276 GGGGCTAGAGGCAGACGTCCCGG - Intronic
1176423550 21:6533999-6534021 AGGTCTGGAGGCAGACCTGGAGG + Intergenic
1176932131 21:14826407-14826429 GAGGGTGGTGGCAGAAATGGTGG - Intergenic
1177153058 21:17473846-17473868 GGGCCTGGTGGCAGACATTTTGG + Intergenic
1178357367 21:31920129-31920151 GAGGAAGGAGGCAGACATTGGGG - Intronic
1178511876 21:33212147-33212169 GCAGCTGGAGGCAGATGTGGGGG - Intergenic
1178531100 21:33376947-33376969 GGCGCTGGAGGAAGACAAGGTGG - Intergenic
1178582118 21:33846153-33846175 GGTGGTGGAGGCTGACATGATGG - Intronic
1178637539 21:34317920-34317942 GAGGGTGGAGGCATCCATGGGGG - Intergenic
1179101922 21:38361612-38361634 GAGGCTGAAAGCAGCCATGGTGG - Intergenic
1179176343 21:39010766-39010788 GGAGCTGGAGGGAGGCCTGGGGG - Intergenic
1179476998 21:41653354-41653376 GGGGCTGGGGGAAGGAATGGTGG - Intergenic
1179567521 21:42258433-42258455 AGGGATGGAGGAAGATATGGAGG - Intronic
1179699044 21:43142315-43142337 AGGTCTGGAGGCAGACCTGGAGG + Intergenic
1179715667 21:43286313-43286335 GGGGCTGGAGGCTGAGATCAAGG - Intergenic
1179849087 21:44127778-44127800 GGGGCTAGAGGCAGACGTCCCGG + Intronic
1179935883 21:44603054-44603076 GGGGGTGGAGACAGAGAAGGAGG + Intronic
1180593751 22:16960867-16960889 GGGAGTGGAGGCAGAGAAGGTGG - Intergenic
1180777843 22:18500817-18500839 GGGGTTAGAGACAAACATGGTGG - Intergenic
1180901307 22:19375414-19375436 GTGGCTGGAAGGAGTCATGGGGG - Intronic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1181668112 22:24412265-24412287 AGGGCTGGGGGCTGACATGGGGG - Intronic
1181801522 22:25350795-25350817 GGGGCTGAAGGGAGTCACGGTGG - Intergenic
1181803208 22:25360463-25360485 GGGGCTGGCAGAAGACAAGGGGG - Exonic
1181855326 22:25777456-25777478 GGATCTGGAGGCAGATCTGGAGG + Intronic
1182024692 22:27108883-27108905 GGAGCTCGAGGCAGCCAGGGTGG - Intergenic
1182104980 22:27682749-27682771 GGGGCTGGATGCAGACTGGAGGG - Intergenic
1183185293 22:36288386-36288408 GGAGATGGAGGCAGAGCTGGAGG - Exonic
1183325331 22:37188298-37188320 GGGGATGGAGGGAGAGAGGGCGG + Intronic
1183432190 22:37772574-37772596 GGGGCAGGAGGCAGGTATGAGGG - Intronic
1183468408 22:37992121-37992143 GGAGCTAGAGCCAGGCATGGTGG - Intronic
1183596653 22:38816747-38816769 GGGTTTGCAGGCAGACTTGGTGG + Intergenic
1184407630 22:44308914-44308936 GGGGCGGGAGGCTGACCTTGGGG + Intronic
1184736031 22:46398276-46398298 GGGGCAGGTGGCTGGCATGGCGG + Intronic
1184776466 22:46625951-46625973 GGAGGAGGAGGCAGGCATGGGGG + Intronic
1184866704 22:47205466-47205488 GGGGAAGGAGGGTGACATGGGGG - Intergenic
1184889056 22:47368496-47368518 GGGGGTGGCTGCAGAAATGGTGG - Intergenic
949097225 3:99822-99844 GTGGCTGCAGGTTGACATGGAGG - Intergenic
950212692 3:11135719-11135741 GGGGCCTGAAGCAGACATGGAGG + Intergenic
950580419 3:13858336-13858358 GGGGCAGGAGGCAGAGGAGGGGG + Intronic
950584875 3:13885131-13885153 GGTGCTGGAGACAGAGATGAAGG - Intergenic
951601693 3:24383391-24383413 GGGGCTGAGGGAAGAAATGGGGG + Intronic
951634090 3:24754088-24754110 GGGGGTGGGGGCAGACACAGTGG - Intergenic
951921099 3:27854790-27854812 TGGGTTGCAGCCAGACATGGTGG + Intergenic
952765792 3:36952951-36952973 GGGGCTGGAGGCAGGACTGATGG + Intergenic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
952942751 3:38455890-38455912 GGGTCTGGAGGCAGTCAGGTGGG - Intronic
953151583 3:40330064-40330086 AGGGCTGCAGGCAGGCCTGGAGG + Intergenic
953496097 3:43388140-43388162 GGGCCTGGATGCAGAAATTGGGG + Intronic
954106067 3:48410420-48410442 GGAGCTGGAGGAGGGCATGGTGG - Intronic
954411042 3:50371220-50371242 TGGGCTCCAGGCAGCCATGGGGG + Intronic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956034291 3:65073550-65073572 GGGCTAGAAGGCAGACATGGTGG + Intergenic
956034321 3:65073844-65073866 TGGGCTGGGTGCAGACATGGTGG - Intergenic
959545911 3:107596248-107596270 GGGGTTGGGGGCAGGAATGGGGG + Intronic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
960625365 3:119677025-119677047 GGGGGGGGGGGCAGACAGGGAGG + Intronic
960715121 3:120567614-120567636 GGGGAGGGAGGGAGACAAGGGGG - Intergenic
960939187 3:122922481-122922503 GGGGATGGCGGCAGCCCTGGTGG - Intronic
960987387 3:123289877-123289899 GAGGCCGGAGGCAGCCATGTAGG + Exonic
961178197 3:124853479-124853501 GGGCTTGGAGGCAGACACTGTGG - Intronic
961442791 3:126962703-126962725 GGGCCATGAGCCAGACATGGAGG - Intergenic
961575760 3:127834937-127834959 GAGGCTGGAGACACACAGGGAGG + Intergenic
961656155 3:128443134-128443156 TGGGCTGGAGGCTGTCCTGGAGG + Intergenic
961744166 3:129053083-129053105 GGGACTGTAGGCATGCATGGGGG - Intergenic
962124004 3:132595365-132595387 AGGGATGGAGGCAGACCTTGTGG + Intronic
963909180 3:150800467-150800489 GGGGATGGGGGCGGCCATGGGGG + Intergenic
964928949 3:161991914-161991936 GGGGCAGGAGGAAGAGTTGGAGG + Intergenic
964969504 3:162542253-162542275 GGGGATGGAGGCAGACAGAGGGG - Intergenic
965540326 3:169865360-169865382 GGGGTGGGAGGCACCCATGGGGG + Intronic
966440350 3:179937994-179938016 GGTGGTGGAGGTAGAGATGGAGG - Intronic
966948643 3:184796053-184796075 GTGGGTGGGGGCAGACATGAAGG + Intergenic
967386127 3:188912736-188912758 GGGGCAGGAGGGAGAGAGGGGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968844890 4:3035481-3035503 GAGGCTGGAGGCAAACATGCTGG + Exonic
968971318 4:3796843-3796865 GGGGCTGCAGTCAGACATCCAGG + Intergenic
969106076 4:4808011-4808033 GGGGCAGGAGGCAGAGATCACGG + Intergenic
969113144 4:4856035-4856057 GGGGATGGAGGCAGGGATGGTGG - Intergenic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969327618 4:6452926-6452948 GGAGCTGGAGTCAGGCATGGTGG - Intronic
969606680 4:8205447-8205469 AGGCCTGGAGGCAGGCAGGGTGG - Intronic
969725391 4:8915353-8915375 GGGGCTGGACAGAGACAAGGCGG + Intergenic
969739193 4:9011972-9011994 GGGACTGGGGGCAGACAAGCGGG - Intergenic
969798381 4:9543485-9543507 GGGACTGGGGGCAGACAAGCGGG - Intergenic
970698667 4:18709285-18709307 GGTCATGGAGGCAGAGATGGAGG + Intergenic
970859273 4:20683160-20683182 GGTGCTGGAAGCAGACTGGGAGG - Intergenic
971448491 4:26778076-26778098 GGGAGGGGAGGGAGACATGGTGG + Intergenic
972505752 4:39718599-39718621 GGGGCAGGACTCAGGCATGGCGG + Intronic
972569123 4:40294787-40294809 GGAGATGGAGGCAGAGATAGAGG - Intergenic
972569233 4:40295447-40295469 GGAGCTGGAGGCAGAGATGGAGG - Intergenic
972569238 4:40295471-40295493 GGAGATGGAGGCAGAGATGGAGG - Intergenic
973829485 4:54743877-54743899 GGTGCTGGAGGAAGACAAAGAGG - Intergenic
976104538 4:81602607-81602629 GGGTGTGGAGGCAGACACTGAGG + Intronic
976183004 4:82416846-82416868 GGGACAGGGGGCAGCCATGGTGG - Intergenic
977273186 4:94943409-94943431 GTGAGTGGAGGCAGACACGGTGG - Intronic
978124060 4:105114562-105114584 GGGGATGGAGGGAGAGAAGGAGG + Intergenic
978862219 4:113464042-113464064 GGTGGTGGTGGCAGATATGGGGG - Intronic
981422966 4:144572286-144572308 GTAGCTGGAGGCAGAGATTGAGG + Intergenic
982070252 4:151688061-151688083 GGGGCCGGAGGCAGGCAGGTGGG - Intronic
982174139 4:152689590-152689612 GAGGCTGGAGGCACAGTTGGAGG + Intronic
982183504 4:152772955-152772977 GAGGCTGGAGGCAGCCGAGGCGG - Intronic
984947724 4:184983068-184983090 GGGGATGGAGGAAGACAGGGAGG - Intergenic
985652297 5:1112603-1112625 GGGGCTGGAGCAGGAAATGGGGG - Intergenic
985846573 5:2354061-2354083 GGGGCTGGAGTCCCACATGCAGG - Intergenic
985890194 5:2709124-2709146 GGGGCAGGAGGTTGAGATGGTGG + Intergenic
985962713 5:3314737-3314759 GGAGCTGGAGTCAAACTTGGAGG + Intergenic
985968074 5:3352845-3352867 GCAGATGGAGGCAGAGATGGGGG - Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986330384 5:6713182-6713204 GGGGCTGGAGGGAGAGGCGGTGG - Intergenic
986494926 5:8332293-8332315 GGGTCTGGAGGCAGACGCGCTGG - Intergenic
986671158 5:10144204-10144226 GGAGATGGAGGCAGAGATTGGGG - Intergenic
987035813 5:14017311-14017333 GTTGCTGGGGGCAGTCATGGAGG - Intergenic
987986559 5:25154611-25154633 GGTGCTAGAGGTACACATGGTGG + Intergenic
990332537 5:54741899-54741921 TGGCTTGAAGGCAGACATGGTGG + Intergenic
990389803 5:55307499-55307521 GGCTCTGGAAGCAGACACGGCGG + Exonic
990755430 5:59064128-59064150 AGGGAAGGAGGGAGACATGGAGG + Intronic
990992970 5:61703057-61703079 TGGGCAGGAGACAGGCATGGAGG - Intronic
991608802 5:68429369-68429391 GGGGCAGGATGGAGACATGGGGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992392859 5:76345349-76345371 GGTGCTGGAGACAGGCAGGGTGG + Intronic
992864875 5:80948057-80948079 AGGGATGTAGGCAGACATGGTGG - Intergenic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993660193 5:90623698-90623720 GGGGCAGGGGGAAGGCATGGTGG - Intronic
994398321 5:99247284-99247306 AGGAATGGAGGCAGGCATGGTGG + Intergenic
996106518 5:119510925-119510947 GGGGCTGGATGGAGAAATAGAGG - Intronic
997299172 5:132789842-132789864 GGGGCTGGAGGCAGGGAGAGTGG - Intronic
997511480 5:134457803-134457825 GGGGCTAGAGGCAGATGGGGCGG + Intergenic
997674174 5:135700601-135700623 AGGGCTGGAGACAGCCAGGGAGG - Intergenic
997770415 5:136548409-136548431 GCCGCTGCAGGCAGACATGAGGG + Intergenic
997831823 5:137157034-137157056 CAGGATGGAGGCAGCCATGGGGG - Intronic
999486247 5:151999135-151999157 GGGGCTGCAGTCAGCCATGCTGG + Intergenic
999519800 5:152339553-152339575 GGGGATGGAGGCAGGCAAGAAGG + Intergenic
1001067087 5:168544139-168544161 GGAGCTGGAGGAAGACAGGGAGG - Intergenic
1001094096 5:168762760-168762782 GGGGTGGGAGACAGAGATGGGGG + Intronic
1001584789 5:172826464-172826486 GGGACTGGAGTCTGACATGGTGG + Intergenic
1001822076 5:174718345-174718367 AGGGGTGGAGGCAGAAAGGGAGG + Intergenic
1001862526 5:175070055-175070077 GGAGCAGGAGGGAGACAAGGGGG + Intergenic
1002058536 5:176612481-176612503 GGGGTGGAAGGCAGCCATGGTGG + Intergenic
1002101659 5:176860901-176860923 TGGGCAGGAGGCAGGCAGGGAGG + Intronic
1002278537 5:178118074-178118096 GGGGTGGGAGGCAGAGAAGGTGG + Intronic
1002473747 5:179452541-179452563 GGGGCTGAAGGCAGCCATGGTGG - Intergenic
1002564145 5:180100509-180100531 GGGGCTGGAAACAGACAGGGTGG + Intergenic
1002567171 5:180118701-180118723 GGTGCTGGAAGGAGACAGGGAGG + Exonic
1002681599 5:180969569-180969591 GGGGCGGGACTCAGGCATGGCGG + Intergenic
1003048168 6:2754514-2754536 GGGGCTGGGTGCAGGAATGGGGG + Intergenic
1003120921 6:3318545-3318567 GGGCCAGGAGGCACACAGGGAGG - Intronic
1003385487 6:5663798-5663820 GGAGCCAGAGACAGACATGGAGG + Intronic
1003529343 6:6924976-6924998 GGGTCTGGAGGCAAGAATGGAGG - Intergenic
1003639189 6:7862409-7862431 CCGGCTGGAGGCTGACCTGGTGG - Exonic
1004266763 6:14154940-14154962 AGGGATAGAGGCAGACAGGGAGG - Intergenic
1004447122 6:15710564-15710586 GGAGATGAAGGCAGACATTGGGG + Intergenic
1004623843 6:17356082-17356104 GAGGCTGGAGTGAGCCATGGTGG + Intergenic
1004755068 6:18601908-18601930 GGGCCCGGAGGCAGACCTGCAGG - Intergenic
1005939883 6:30553043-30553065 AGGGCTGTAGGAGGACATGGGGG - Intronic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006140090 6:31923301-31923323 GGGGTGGGAGGCAGACTTGATGG + Intronic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006184972 6:32176259-32176281 GCAGCTGGAGCCAGAGATGGGGG - Intronic
1006193781 6:32224713-32224735 GCGGAGGGAGGCAGAGATGGAGG - Intergenic
1006373461 6:33659196-33659218 GGGGCTGGAGGCAGAGACCATGG - Intronic
1006397626 6:33797353-33797375 AGGGCTGGAGGCTCACATGTAGG - Intronic
1006435187 6:34022458-34022480 AGGGCTGGAGACAGACAGAGGGG + Exonic
1006529003 6:34633854-34633876 GGGAGGGGAGGGAGACATGGAGG + Intronic
1006686354 6:35837843-35837865 GAGACTGGAGCCAGGCATGGTGG - Intronic
1006898728 6:37486583-37486605 GGGGCTGGAGGTGGCCATGGTGG - Intronic
1006902298 6:37511028-37511050 GGGGATGGAGGGAGCCATGTAGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1007189150 6:39998689-39998711 GGGGCTGAGGGCAGAGAAGGTGG - Intergenic
1007607173 6:43125394-43125416 GGTGCTGGAGGCTGAGCTGGGGG + Intronic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007722218 6:43891743-43891765 GGGGAGGGTGGCAGGCATGGCGG + Intergenic
1007742752 6:44022821-44022843 GGGGCTGGAGGCGGGCATGCTGG - Intergenic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1007856279 6:44861675-44861697 GTGGCTGGGGCCAGGCATGGTGG - Intronic
1010009673 6:71035937-71035959 GGGACTGGAGGAAGACTTGGAGG + Intergenic
1010204548 6:73310436-73310458 GGGGCTGGAGCCAGAAACGCAGG + Intergenic
1010568927 6:77454263-77454285 AGGGTTGGAGTCAGACAGGGAGG + Intergenic
1010826645 6:80484205-80484227 GCCGCTGCAGGCAGACATGAGGG + Intergenic
1011615942 6:89198533-89198555 GTGGCTTGAGTCACACATGGTGG - Intronic
1012448313 6:99328791-99328813 AAGGCTGGAGGCAGACATCAAGG - Intronic
1013059102 6:106614564-106614586 AGGGCTGGAGGAAGAAGTGGGGG + Intronic
1013196182 6:107847212-107847234 GGGGTAGGGGGCAGGCATGGTGG + Intergenic
1013292025 6:108728129-108728151 GGAGCTGGAGGGGGACTTGGAGG + Intergenic
1016562303 6:145410256-145410278 GGGGATAGAAGAAGACATGGGGG + Intergenic
1016572790 6:145533523-145533545 GGGGATGGAGGCAGAGAAGTAGG - Intronic
1016573411 6:145540082-145540104 CAGGCTGGAGGCAGACACGGCGG - Intronic
1016853489 6:148643431-148643453 GCCGCTGCAGGCAGACATGAGGG - Intergenic
1017002297 6:150005006-150005028 GGGGCTGGGGCCAAACTTGGCGG - Intergenic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017667953 6:156739658-156739680 GGGGCTGGGGCCGGGCATGGTGG - Intergenic
1017727090 6:157283318-157283340 GGAGAGGGAGGCAGCCATGGAGG + Intergenic
1017805527 6:157942458-157942480 GGGGCTCTAGGCAAACATGAAGG + Intronic
1017873186 6:158503172-158503194 GGGGCTGGCAGGAGACTTGGGGG - Exonic
1017912461 6:158805863-158805885 GGGGCTGTGGGCAGGGATGGGGG - Intronic
1018416480 6:163606364-163606386 GGTGCTGGGGCCAGGCATGGTGG - Intergenic
1018612554 6:165660346-165660368 GGGGTGGGAGGCAGACACCGGGG + Intronic
1018618625 6:165709781-165709803 GAGGCTGGAAGCAGAGATGCCGG - Intronic
1018681086 6:166265940-166265962 GGGGCTTGAGGAGGACAGGGAGG + Intergenic
1018750511 6:166800267-166800289 GGGGCTGAGGGCAGACACAGTGG - Intronic
1018897053 6:168027079-168027101 GGGGCAGGAGGCAGAGATGGGGG + Intronic
1019029332 6:168996473-168996495 GACACTGGAGGCAGACTTGGAGG - Intergenic
1019283669 7:212962-212984 GGGGCTGGAGGCGGACAAGGGGG - Intronic
1019345085 7:525730-525752 GGGGCTGGAGGAGGACAGGGAGG + Intergenic
1019348893 7:544022-544044 GGGGCAGGAGGCAGACCAGTGGG - Intergenic
1019464778 7:1181616-1181638 GGGCCTGGAGGCAGGCAGGCAGG + Intergenic
1019521250 7:1461446-1461468 GGGGCAGGAGGCAGCCCTGTGGG - Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1019705493 7:2495446-2495468 GTGGCTGGAGGCAGGGGTGGAGG + Intergenic
1019737084 7:2655991-2656013 TGGGCTGGAGGGAGACCTGGGGG + Intronic
1019959621 7:4448347-4448369 GGGGCTGAAGTGAGAGATGGGGG - Intergenic
1020058524 7:5135271-5135293 AGGGCTGAAGGCAGAGAAGGTGG + Intergenic
1020279370 7:6642634-6642656 GGAGGTGGAGGCGGACGTGGAGG + Exonic
1020430679 7:8113508-8113530 GAGGCTGGGGGCAGAGAAGGAGG + Exonic
1021270425 7:18578000-18578022 GGAGGTGGAGGCAGAAGTGGGGG - Intronic
1021270431 7:18578018-18578040 GGGGATGGAGATAGAGATGGAGG - Intronic
1021589183 7:22242225-22242247 GGTGCTGGGGGCAGACTTTGGGG - Intronic
1021841638 7:24726028-24726050 GAGGCGGCAGGCAGAGATGGAGG + Intronic
1022026895 7:26456461-26456483 TGGGCTCAAGGCTGACATGGAGG - Intergenic
1022232765 7:28429896-28429918 GAGGCTGGAGGCAGCGAAGGAGG - Intronic
1022469056 7:30670768-30670790 GGGGCTGGATGCAGAGAGGTGGG + Intronic
1022539197 7:31120877-31120899 GGGGCTGTAGACAGTCCTGGGGG - Intergenic
1023336355 7:39174863-39174885 GGGGCTTGAGGAGTACATGGGGG - Intronic
1023855102 7:44178071-44178093 GGGGATGGGGGTAGACAGGGAGG + Intronic
1024064214 7:45719127-45719149 GTCTCTGGAGGCAGACAGGGTGG + Exonic
1025007549 7:55366064-55366086 GGGAGGGGAGGCAGAAATGGAGG + Exonic
1025079315 7:55968171-55968193 GGGAATGGGGGCAGACAGGGAGG - Intronic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026800596 7:73397721-73397743 GGTGCTGGAGGAAGAGAAGGGGG + Intergenic
1029374319 7:100168669-100168691 GGGGCTGGCGGCACAAAGGGAGG - Exonic
1029445902 7:100612723-100612745 GGGCCTGGAGTCAGAGCTGGGGG - Exonic
1029737410 7:102472490-102472512 GGAGCTGGAGGCAGACGTGGGGG + Exonic
1029792915 7:102864161-102864183 GAGGCTGGAGAAAGAGATGGAGG - Intronic
1030084983 7:105808155-105808177 GGGCCTGCAGGCAGCCCTGGTGG + Intronic
1030791029 7:113729337-113729359 GGTGCAGGAGGCAGAAGTGGGGG - Intergenic
1031008466 7:116499784-116499806 GGGGCTGGAGACGGAGAAGGCGG + Exonic
1032023179 7:128421440-128421462 GGGGATGGAGGGAGGCTTGGGGG - Intergenic
1033581940 7:142745988-142746010 GGGGCGGGAGGCAGGCGGGGAGG + Intergenic
1034421800 7:150994636-150994658 GGGGCTGCAGGCAGCTATGCAGG + Intronic
1034460369 7:151194663-151194685 GGAAATGGAGGCAGAGATGGGGG + Intronic
1034504465 7:151476283-151476305 GTGGCTGGAGGCTGCCATGTTGG - Intronic
1034595222 7:152183472-152183494 GGGGCTGGGGCCAGGCATGGTGG + Intronic
1034940644 7:155228185-155228207 GGGGCTGGAGGCGGCCACAGGGG + Intergenic
1035448881 7:158961737-158961759 AGGGCTGGAATAAGACATGGAGG + Intergenic
1035449041 7:158963422-158963444 GGGTCTGGAGCTAGACAAGGGGG + Intergenic
1035896226 8:3405703-3405725 GAGTCTGGAGGCAGAGATGAGGG + Intronic
1036361012 8:8076938-8076960 TGGGGTGGAGGCAGACAAGCAGG - Intergenic
1036583423 8:10099990-10100012 GGGGATGGAGACAGAGAAGGTGG + Intronic
1036589886 8:10159368-10159390 TGGGCTGGAGGCAGACATTTGGG + Intronic
1036889952 8:12590063-12590085 TGGGGTGGAGGCAGACAAGCAGG + Intergenic
1036909714 8:12746272-12746294 TGGGCAGGAGCCAGGCATGGAGG - Intronic
1036963754 8:13273741-13273763 GGGGAGGGAGGGAGACAGGGAGG + Intronic
1037686172 8:21141442-21141464 GGAGATGGAGGGGGACATGGGGG + Intergenic
1037866062 8:22443233-22443255 GGGGCTAGGGGCAGGCATGGTGG + Intronic
1037949648 8:23010596-23010618 GGGGCTGGAGGTGAACATGCCGG - Exonic
1038870729 8:31490129-31490151 GGGGCGGGACTCAGGCATGGCGG - Intergenic
1039085894 8:33779157-33779179 GGGGATGGAGGCAGACAGAGAGG - Intergenic
1039799459 8:40941745-40941767 GTGGGGGGAGGCAGGCATGGTGG - Intergenic
1039986505 8:42452298-42452320 GGAGGTGGAGGAAGAGATGGAGG + Intronic
1041045020 8:53880518-53880540 GGGGTGGGCGGCAGGCATGGAGG - Intronic
1041066904 8:54091155-54091177 GAGGTTGGAGCCAGGCATGGTGG - Intronic
1041170887 8:55141260-55141282 GGGGCTGGAGGCAGAGGAGGAGG - Intronic
1042591487 8:70402759-70402781 GGGGCGGGAGGCGGACCGGGAGG - Intronic
1044636737 8:94332720-94332742 TGGGTGGGAGGGAGACATGGAGG - Intergenic
1045290190 8:100826271-100826293 GGAGCTGGAGCCCGGCATGGTGG + Intergenic
1045649151 8:104326656-104326678 GTGGCAGGTTGCAGACATGGAGG - Intergenic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1046748031 8:117896955-117896977 GGGGGTGAAGGGAAACATGGAGG - Intronic
1046958197 8:120083248-120083270 GGGCCAGGAGGAAGACATGGTGG - Intronic
1047495462 8:125405645-125405667 GGGGCAGTAGCCAGACTTGGAGG - Intergenic
1047713877 8:127577754-127577776 GGGGCTGGAGGCATACAAACTGG - Intergenic
1047735728 8:127763400-127763422 GGGGCTGGAGGCTGATATCTGGG - Intergenic
1047956620 8:129981436-129981458 GGGGCTGGAGCCAGGCACAGTGG - Intronic
1048278137 8:133083012-133083034 GTGGCGTGGGGCAGACATGGAGG + Intronic
1049013944 8:139906554-139906576 GGGGCAGGAGGGAGAGAAGGGGG + Intronic
1049014117 8:139907550-139907572 AGGGATGGAGGCAGAGAGGGAGG + Intronic
1049055622 8:140234369-140234391 GTGGCTGGTGGCTGCCATGGTGG + Intronic
1049199534 8:141333276-141333298 GGGGCTGGAGCCAGAGAAAGGGG + Intergenic
1049246044 8:141563142-141563164 CCGGCTGCAGGCAGGCATGGGGG + Intergenic
1049323986 8:142012260-142012282 GGGGAGGGAGGGAGTCATGGAGG + Intergenic
1049417616 8:142502532-142502554 GAGGATGGAGGCAGAGGTGGTGG + Intronic
1049587440 8:143438589-143438611 GGGCCTGGAGGCAGGCAGTGTGG + Intronic
1050286641 9:4109727-4109749 GAGGCTGGAGGAAGTCATGAAGG - Intronic
1051146951 9:14036955-14036977 GGGCATGGGGGCAGGCATGGTGG + Intergenic
1051196211 9:14565158-14565180 GTGGTGGGAGGCAGGCATGGAGG + Intergenic
1051305060 9:15700139-15700161 GGGGTGGGAGGCAGGCATGGCGG + Intronic
1051367314 9:16330105-16330127 GGGGCAGGAGGCAGGGATAGTGG + Intergenic
1052900658 9:33791952-33791974 GGGGCAGGAGGCAGGCAGGGAGG + Intronic
1052970440 9:34373962-34373984 GGGGCAGGAGCCTGGCATGGGGG + Intronic
1053304131 9:36972159-36972181 AAGGCTGGAGGCTGACCTGGCGG - Intronic
1054743254 9:68829427-68829449 GGGGGTGGAGGCAGAATTGCTGG - Intronic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1056890670 9:90488838-90488860 CGAGCTGGAGGCAGGGATGGGGG + Intergenic
1057113638 9:92499689-92499711 GGTACTGGAGGAAGAGATGGGGG - Intronic
1057219248 9:93247219-93247241 GGGGCTGGTGGCAGACGGGAAGG - Intronic
1057649766 9:96910207-96910229 GGAGCAGGAGGCTGACAAGGAGG + Intronic
1057897896 9:98924413-98924435 GGGGCTTGAGACAGGGATGGGGG - Intergenic
1058053375 9:100427467-100427489 GGGGCCGGGGGCCGGCATGGAGG + Intronic
1058904862 9:109474463-109474485 GGTGCTGGAGGAACACAAGGAGG + Intronic
1059268337 9:113056671-113056693 GCCGCTGGAGACCGACATGGCGG + Exonic
1059609627 9:115878540-115878562 GAGGCTGGAGAGAAACATGGGGG - Intergenic
1059937805 9:119329026-119329048 GAGCTTGGAGGCAGACTTGGAGG + Intronic
1060260615 9:122070786-122070808 GGGTGTGGAGGCAGACAGAGGGG + Intronic
1060399644 9:123340723-123340745 GGGGCTGGAGGGGAACAAGGTGG + Intergenic
1060599689 9:124869551-124869573 GGAGCTGGAGGCTGACCTGAGGG - Intronic
1060815937 9:126635180-126635202 GGAGCTGGAGTCAGACCTGGTGG - Intronic
1060881923 9:127123288-127123310 GAGGGTGGAGGCAGCCCTGGAGG + Intronic
1061607613 9:131722904-131722926 GGGGCGGGGGGCAGGCATGGTGG + Intronic
1061657006 9:132099907-132099929 GGGGCTGGGGACAGTCAGGGAGG + Intergenic
1061687925 9:132298581-132298603 GGGGATGGAGGCAGATAAGCTGG + Intronic
1061705334 9:132448872-132448894 GAGGCTTCAGGCAGGCATGGTGG - Intronic
1061720892 9:132550750-132550772 GGGGATGGAGGCTGACAAGTGGG - Intronic
1061764960 9:132875769-132875791 AGGGCTCTAGGCAGACAAGGAGG - Intronic
1061905332 9:133693759-133693781 GGGTATGCAAGCAGACATGGTGG + Intronic
1061967545 9:134024928-134024950 GGAGCTGGAGGAAGACGTGGAGG - Intergenic
1062079922 9:134618406-134618428 GGAGCTGGAGGAAGCCAAGGAGG - Intergenic
1062118033 9:134819568-134819590 GGGGCTGGGGGCAGTGGTGGCGG - Intronic
1062216678 9:135393119-135393141 AGGGCTTGAGGCAGGCAAGGTGG - Intergenic
1062267470 9:135693859-135693881 GGAGCTTGAGGCAGACAGGTGGG + Intronic
1062293040 9:135805982-135806004 GGTCCTGGAGGCAGACCTGCTGG - Intergenic
1062395228 9:136350114-136350136 GGGGCTGGAGTCAGAGAGAGAGG - Intronic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1062712559 9:137984620-137984642 GGGGAGGTAGGCAGACTTGGGGG - Intronic
1203773769 EBV:61874-61896 CGGGATGGCGGCAGAGATGGAGG - Intergenic
1185858210 X:3555214-3555236 GCTGCTGCAGGCAGACATGATGG + Intergenic
1185975324 X:4713782-4713804 GGGGCCGGGGGCAGGCATGGTGG - Intergenic
1185991275 X:4895212-4895234 GCTGCTGCAGGCAGACATGAGGG - Intergenic
1186213891 X:7279014-7279036 GGGGCTTGGGCCAGGCATGGGGG + Intronic
1186295259 X:8142051-8142073 GGGTCTGGAGGCTGACTGGGTGG + Intergenic
1186438890 X:9567678-9567700 TGGCCTGGAAGGAGACATGGTGG - Intronic
1186883733 X:13891767-13891789 GAGGCTGGAGGAAGGCAAGGAGG + Intronic
1189494420 X:41496221-41496243 AGGACTGGAGGCAGAGATGAGGG + Intergenic
1190179278 X:48177675-48177697 GGGGCTGGAAGGAAACAGGGTGG + Intergenic
1190215957 X:48479567-48479589 GGGGATGGGGCCAGGCATGGTGG + Intronic
1190267582 X:48836437-48836459 TGGGCTGGGGCCAGGCATGGTGG - Intergenic
1190887381 X:54541638-54541660 GGGGCTGGTGGCGGAGTTGGGGG + Intronic
1190994377 X:55592138-55592160 GGGGTTTGAGGTAGAGATGGGGG - Intergenic
1191684323 X:63873317-63873339 GGGGAGGGAGGGAGAAATGGAGG + Intergenic
1191786909 X:64925880-64925902 TTGGATGGAGGCAGACATTGTGG - Intronic
1192149559 X:68703697-68703719 GGGGTGGGATGCAGACGTGGTGG + Intronic
1192166906 X:68832173-68832195 CGGGCAGGAGGCAGAGAGGGAGG - Intronic
1192452704 X:71253715-71253737 GGGGGTGGGGCCAGACAGGGTGG - Intronic
1194214440 X:91110958-91110980 GGGGCTTGAGGCAGCCACTGTGG + Intergenic
1194427432 X:93756826-93756848 GGAGGTGGGGGCAGAGATGGGGG + Intergenic
1195105449 X:101598844-101598866 GGGGCTGGAGGCGGGGGTGGGGG + Intergenic
1195107433 X:101614923-101614945 GGGGCTGGAGGCGGGGGTGGGGG - Intergenic
1196410086 X:115409318-115409340 GGTACTGGAGCAAGACATGGGGG - Intergenic
1196897704 X:120353893-120353915 TGGGCTGGAGCCAGAGGTGGTGG + Intergenic
1199594026 X:149492856-149492878 GGGGCATCAAGCAGACATGGGGG + Intronic
1199641988 X:149871275-149871297 TGGGATGAAGGCAGACATTGTGG - Intergenic
1200058411 X:153473323-153473345 GGGGCTGGAGTTAGACCTGAGGG + Intronic
1200088596 X:153623986-153624008 GGAGATGGAGGCAGAAATTGAGG + Intergenic
1200133142 X:153862310-153862332 CTGACTGGGGGCAGACATGGTGG - Exonic
1200213788 X:154358560-154358582 GGGGCTGGGGCCAGGCCTGGTGG - Exonic
1201851069 Y:18480285-18480307 GAAGCTAGAAGCAGACATGGGGG - Intergenic
1201882250 Y:18840093-18840115 GAAGCTAGAAGCAGACATGGGGG + Intergenic
1202330473 Y:23747472-23747494 GAAGCTAGAAGCAGACATGGGGG + Intergenic
1202540296 Y:25922589-25922611 GAAGCTAGAAGCAGACATGGGGG - Intergenic