ID: 1017418445

View in Genome Browser
Species Human (GRCh38)
Location 6:154246670-154246692
Sequence CTGTATAAGAAAAAGGAAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1337
Summary {0: 1, 1: 0, 2: 11, 3: 108, 4: 1217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017418445_1017418449 -1 Left 1017418445 6:154246670-154246692 CCCTTTTCCTTTTTCTTATACAG 0: 1
1: 0
2: 11
3: 108
4: 1217
Right 1017418449 6:154246692-154246714 GCCACCCTTGGCAGTCAGCATGG 0: 1
1: 0
2: 2
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017418445 Original CRISPR CTGTATAAGAAAAAGGAAAA GGG (reversed) Exonic
900248095 1:1648774-1648796 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900259314 1:1715931-1715953 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900674068 1:3872993-3873015 CTCTAAAAGAAAAAGAAAAAGGG - Intronic
900875372 1:5338671-5338693 CTGTTATAGAAAAAGGCAAAGGG + Intergenic
901106569 1:6760906-6760928 CTGTCTCAAGAAAAGGAAAAAGG + Intergenic
901832812 1:11903771-11903793 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
902098056 1:13962556-13962578 CTCAAAAAGAAAAAAGAAAATGG - Intergenic
902163252 1:14549612-14549634 CTGAATAAAAAAAAAAAAAAAGG - Intergenic
902433751 1:16383622-16383644 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
903351822 1:22721619-22721641 CTGTCTAAGAAAAAAGAGAGAGG - Intronic
903728855 1:25474476-25474498 CTGAAGAAGAAAAAGCAAAAAGG - Intronic
904191632 1:28749087-28749109 CTTTTCAGGAAAAAGGAAAAAGG - Intronic
904333375 1:29781271-29781293 ATTCATAAGAAAAAGGATAAGGG + Intergenic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
904865614 1:33576802-33576824 CTGAAGAAGAAAAAAAAAAACGG - Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905082453 1:35336388-35336410 CTGTATCAAAAAAAAAAAAAAGG - Intronic
905400810 1:37701791-37701813 CCATACAAGGAAAAGGAAAAGGG + Exonic
905579532 1:39073300-39073322 CTCAAAAAGAAAAAAGAAAAAGG + Intergenic
905716779 1:40159163-40159185 TAGTATAGGAAATAGGAAAATGG - Intergenic
906324548 1:44836710-44836732 ATGGAAAAGAAAAAGAAAAAAGG + Intronic
906564662 1:46790381-46790403 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
907166605 1:52416982-52417004 CGGTTTAATAAAAAGGGAAAGGG - Exonic
907228720 1:52975051-52975073 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
907400067 1:54219600-54219622 CTGTAAAATAAAAAGTAAAATGG - Intronic
908129744 1:61063342-61063364 AGGTATATTAAAAAGGAAAACGG + Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908645208 1:66270770-66270792 AATTATAAGAAAAAAGAAAAAGG + Intronic
909122029 1:71615578-71615600 CTGTTTTAGAAATAGCAAAATGG + Intronic
909317275 1:74239462-74239484 CTTTATAAGACAAATGAATAAGG - Intronic
909337261 1:74490223-74490245 CTGAATAAGAGAAGGGAAAGAGG - Intronic
909441072 1:75696882-75696904 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
909448450 1:75773130-75773152 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
909534738 1:76723956-76723978 TTGTATTAAAAAAAGAAAAAAGG - Intergenic
909580307 1:77225507-77225529 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
909618697 1:77643043-77643065 CTGTACAAAAAAATAGAAAAAGG + Intronic
909779821 1:79529748-79529770 CTGTATAAGAAACAGATAAGAGG + Intergenic
910017224 1:82540791-82540813 CAGAAGAAGAAAAGGGAAAAGGG + Intergenic
910212911 1:84812254-84812276 CTGTACAAGAAAAGAGAAAGAGG - Exonic
910502343 1:87907219-87907241 CCCTATAAGAAAAAGGCAAAGGG - Intergenic
910676142 1:89819044-89819066 CTGTAAAAGTAAGAGGAAATTGG - Intronic
910813413 1:91262150-91262172 CTTTAAAATGAAAAGGAAAACGG + Intronic
910898534 1:92094358-92094380 CTGTATGAAAAGAAGGCAAAAGG + Intronic
910918062 1:92312824-92312846 CTGTCTGAAAAAAAGAAAAAAGG - Intronic
911276082 1:95860832-95860854 CTGTACAAGCAAGAAGAAAATGG - Intergenic
911288159 1:96023501-96023523 GTGTATAAGAGAAATGGAAAGGG - Intergenic
911601444 1:99852373-99852395 CTGTCTCAGAAAAAGAGAAAAGG - Intronic
911700102 1:100942820-100942842 CTGTGTATGAAAAAAGTAAAAGG + Intronic
911905715 1:103566085-103566107 ATGTAGAAGAGCAAGGAAAATGG - Intronic
911971835 1:104448581-104448603 CTGACAAAGAAAAAAGAAAACGG - Intergenic
912005831 1:104899946-104899968 CTGTATAACCAAAAGTAAACAGG + Intergenic
912013911 1:105007025-105007047 CTGTGTAAGAAGCATGAAAAAGG - Intergenic
912228489 1:107763886-107763908 CTGAACAAAGAAAAGGAAAAGGG + Intronic
912260417 1:108106756-108106778 CTGTACTAGACAATGGAAAACGG - Intergenic
912341131 1:108916258-108916280 CTGAAAAAAAAAAAAGAAAAAGG + Intronic
913506133 1:119517595-119517617 CTGTTTAAGAAATTTGAAAAAGG - Intergenic
914935973 1:151980601-151980623 CTGTATGAGGAAAATAAAAATGG - Intergenic
914958562 1:152186405-152186427 CACTATAAGAAACAGAAAAAGGG - Intergenic
915057497 1:153148729-153148751 CAAAATAACAAAAAGGAAAATGG - Intergenic
915174710 1:154005152-154005174 ATGGATAAGAAAAAGAAAAGAGG - Intronic
915220827 1:154373099-154373121 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
915290707 1:154881273-154881295 CTAGAGAAGGAAAAGGAAAAAGG + Intergenic
915381595 1:155446182-155446204 CTGTATAATAAAAAGTACAGTGG - Intronic
915777867 1:158510887-158510909 CTGTCTCAAAAAAAGAAAAATGG - Intergenic
915841908 1:159220161-159220183 CTGTCTAAGAACCAGGAAACTGG - Intergenic
915852732 1:159343549-159343571 CTGAATTCCAAAAAGGAAAAAGG - Intergenic
915909982 1:159908917-159908939 CTGTCTAAGAACAACGAGAAAGG + Intergenic
916185423 1:162127522-162127544 CTTTATAAAAAAAAAAAAAAAGG + Intronic
916310243 1:163390325-163390347 CTGTATAAAAAAGAGGAGAAAGG + Intergenic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
917605096 1:176619728-176619750 AAGTATATGAAAAAGAAAAATGG - Intronic
917660019 1:177169109-177169131 CTGTAAAAGAGAGAGGAAAGAGG - Intergenic
917698109 1:177550366-177550388 CTGTATACTAAAAAAAAAAAGGG - Intergenic
917732056 1:177884450-177884472 CTATAGAAGAAAATGGAAGATGG + Intergenic
917882857 1:179356519-179356541 CTGTACAAGAAAAAAAAAACTGG - Exonic
917889539 1:179421681-179421703 CTAAATAAGAAAAAAGATAAAGG - Intronic
917986784 1:180327664-180327686 GGGTTTAAGTAAAAGGAAAAAGG - Intronic
918029106 1:180786332-180786354 CTGTCTAGGAATAAGGAAAATGG - Intronic
918160997 1:181899541-181899563 CATGACAAGAAAAAGGAAAAAGG - Intergenic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918422684 1:184379991-184380013 TTGTATTATAAAAAGGAGAAAGG - Intergenic
918512166 1:185323167-185323189 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
918942733 1:191023166-191023188 ATGTATTAGAAAAAGTCAAAAGG + Intergenic
919083787 1:192896197-192896219 GGGGATAAGAAAAAGGAAAGAGG + Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919605071 1:199671843-199671865 CTATACAAGAGAAAGGAAGAAGG + Intergenic
919729932 1:200907208-200907230 CTGTCAAAAAAAAAGAAAAAGGG - Intronic
921071615 1:211663653-211663675 CTTTAGAAGGAAAAAGAAAAAGG + Intronic
921113448 1:212062720-212062742 CTCAATAACAAATAGGAAAAAGG - Intronic
921301096 1:213752352-213752374 ATGTAAAAGAAAAAAAAAAAGGG + Intergenic
921304381 1:213781259-213781281 GGGAATGAGAAAAAGGAAAATGG + Intergenic
921426215 1:215003840-215003862 CTGTGTTACAAAAAGGGAAAAGG - Intergenic
921578122 1:216862227-216862249 CTGTCTAAAAAAAAAAAAAAGGG - Intronic
921711637 1:218378770-218378792 CTGTATAAGAAAAAAAAAACAGG - Intronic
921740339 1:218677456-218677478 CTGAATAAGAAATGAGAAAAGGG - Intergenic
922023953 1:221733299-221733321 GTGTATAGGAGAAAGGAGAAGGG - Intronic
922098715 1:222464448-222464470 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
922351224 1:224736126-224736148 CAAAAAAAGAAAAAGGAAAAAGG - Intronic
922559188 1:226555887-226555909 CTATATCATAAAAAGTAAAAAGG + Intronic
922680636 1:227592471-227592493 ATGTGTCAGAAAAAGAAAAATGG - Intronic
923301471 1:232644565-232644587 CAATTTAAAAAAAAGGAAAAAGG + Intergenic
923360239 1:233203986-233204008 GCGTTTAAGAAAAAGGACAAGGG - Intronic
923370362 1:233305283-233305305 TTGTATAAAAAAAAGCACAAAGG + Intergenic
923645559 1:235817016-235817038 CTTTATAAGTAAAAGACAAATGG + Intronic
923737462 1:236624277-236624299 CTGTCTCCGAAAAAGGAAATAGG + Intergenic
924589426 1:245389115-245389137 CTGTCTCAAAAAAAAGAAAATGG - Intronic
1062904694 10:1171862-1171884 CTTTACAAGAAAGAAGAAAAGGG + Intergenic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063368488 10:5506389-5506411 CTGTATCAAAAAAAAAAAAAAGG - Intergenic
1063373025 10:5533916-5533938 CAATGTCAGAAAAAGGAAAATGG + Intergenic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064215258 10:13394878-13394900 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1064486482 10:15797689-15797711 ATGTATCAGAAAAAGGAAAGAGG - Intronic
1064536079 10:16359327-16359349 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1064591846 10:16900851-16900873 CTGCAGGAGAAAAAAGAAAATGG + Intronic
1064605845 10:17037941-17037963 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
1064851367 10:19712543-19712565 TTGTCTAAAAAATAGGAAAAAGG + Intronic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065003239 10:21356383-21356405 CTCTAAAAAAAAAAGAAAAAGGG + Intergenic
1065061819 10:21910114-21910136 CTGAAAAAGAAAAAAAAAAAAGG - Intronic
1065159396 10:22903480-22903502 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1065683596 10:28262143-28262165 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1065850113 10:29780792-29780814 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1066095850 10:32071555-32071577 CAGTATAAGAGAAAGTAAAGTGG - Intergenic
1066223247 10:33356555-33356577 CTATGTAAGAAAAAGGAATTAGG - Intergenic
1066229078 10:33414296-33414318 CTGTATAACAACAAGGAACCTGG + Intergenic
1066363787 10:34756459-34756481 TTTTATAAGAAAAAAAAAAAAGG - Intronic
1066784401 10:38987153-38987175 ATGTCTCAGAGAAAGGAAAAAGG + Intergenic
1066975306 10:42362847-42362869 GTGTATAGAAAAAAGGAAAGTGG + Intergenic
1067055607 10:43048187-43048209 TGGTAAAAGAAAAATGAAAACGG - Intergenic
1067104571 10:43357590-43357612 CTGTATTAAAAAAAGAAAATGGG + Intergenic
1067262129 10:44702991-44703013 CTGAAGAACACAAAGGAAAAAGG - Intergenic
1067689456 10:48492104-48492126 TTTCATAAGAAAAAGAAAAAAGG + Intronic
1067839279 10:49663223-49663245 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1068057228 10:52026234-52026256 TTCTAAAAGAAAAAGGAATATGG + Intronic
1068180626 10:53513515-53513537 CTTTATAAGAAAATGTAAAGAGG + Intergenic
1068739078 10:60448498-60448520 CTGTCTTAGAAAACAGAAAATGG - Intronic
1069055935 10:63844778-63844800 CTGTAGAACTAAAAGGAACAGGG + Intergenic
1069159639 10:65078303-65078325 AAGTATAAGAAAGAGGACAAAGG - Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1069473808 10:68715691-68715713 CTCAAAAAAAAAAAGGAAAAAGG - Intergenic
1069560313 10:69424609-69424631 GTGAAAAAGAAAAAGGAAACAGG + Intergenic
1069565999 10:69463972-69463994 CTTTATAAGAGAAAGGCAGAGGG + Intronic
1069968247 10:72140190-72140212 CTATTTAAGAAAAAGAAGAAAGG + Intronic
1070055223 10:72927912-72927934 AGGAAGAAGAAAAAGGAAAAAGG - Intronic
1070091626 10:73291565-73291587 TTGAAGAAGAGAAAGGAAAAAGG + Intronic
1070105221 10:73425192-73425214 CTGTGGAACAAAAATGAAAATGG + Intronic
1070275638 10:75003622-75003644 CTGTAATATAATAAGGAAAATGG + Intronic
1070295698 10:75159524-75159546 ATGTGCAAGAAAATGGAAAAGGG - Intronic
1070491822 10:76983720-76983742 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1071124953 10:82323012-82323034 AAGGAGAAGAAAAAGGAAAAAGG + Intronic
1071223555 10:83498614-83498636 ATTTAAAAGAAAAAGGAAAAAGG + Intergenic
1071701047 10:87936653-87936675 GTGTATAAGAAGGAGGAAAGAGG - Intronic
1071918258 10:90320680-90320702 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1071984956 10:91041086-91041108 CTGGCTAAAATAAAGGAAAATGG - Intergenic
1072524071 10:96256029-96256051 GCCAATAAGAAAAAGGAAAAGGG + Intronic
1072794279 10:98342511-98342533 CTGTATATTAAAAAGAGAAATGG - Intergenic
1072959733 10:99918484-99918506 CTGGATATGAAAAGGGGAAAGGG - Intronic
1073408935 10:103323594-103323616 CTATATCAAAAAAAAGAAAAGGG - Intronic
1073580357 10:104660043-104660065 CTGTGTGAGAAAAAAGAGAAAGG - Intronic
1073617654 10:105013396-105013418 TAAAATAAGAAAAAGGAAAAAGG + Intronic
1073826225 10:107325467-107325489 TTGTAAAAGAAAATGTAAAATGG - Intergenic
1073859662 10:107723169-107723191 CTTTATGAGAAACATGAAAATGG + Intergenic
1074269546 10:111940106-111940128 CTGTTTAATAAAAAGAAAAAAGG - Intergenic
1074699319 10:116079469-116079491 CTTTATACTAACAAGGAAAATGG - Intronic
1076094265 10:127718308-127718330 CTGTTAAAGAAAAATAAAAATGG + Intergenic
1077094409 11:793209-793231 CTGTCTGCGACAAAGGAAAATGG + Intronic
1077510868 11:2961696-2961718 CTTTAAAAGAGAAAGTAAAAAGG - Intronic
1077758082 11:5057872-5057894 CTGGATTAGAAAAAGGACATTGG - Intergenic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078127201 11:8579067-8579089 CAGAATAAGAAAAAAGAAAAAGG - Intronic
1078179271 11:8997071-8997093 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1079404108 11:20130030-20130052 TAGCAGAAGAAAAAGGAAAAAGG + Intergenic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1080579937 11:33633999-33634021 CTAGAAAAGAAACAGGAAAAGGG - Intronic
1080652474 11:34233652-34233674 CTTTATAATAAAAAAAAAAAAGG - Intronic
1080702695 11:34657783-34657805 CTGTCTCAGAAAAAAAAAAAAGG + Intronic
1081032698 11:38106532-38106554 CTGGAAAAGAAAAATTAAAATGG - Intergenic
1081225288 11:40513823-40513845 CTGAGTAAGAAAAAAGAAAATGG - Intronic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1081555915 11:44160938-44160960 ATGAATAAGAAAACAGAAAAAGG - Intronic
1081834363 11:46142109-46142131 CTGTATAAAAAAGAAGAAGAAGG + Intergenic
1081882566 11:46466340-46466362 CTGTCTAAAAAAAAAAAAAAGGG + Intronic
1082204012 11:49408959-49408981 AAGTATAAGAAAAAGTACAATGG + Intergenic
1082852255 11:57775854-57775876 CCATATAAGAACAAGGAAACAGG - Intronic
1082969872 11:59008799-59008821 CTGGATAACAAAAAAGATAAGGG + Intronic
1083059924 11:59859117-59859139 CTGTCTGAGAAAAAAGAAAATGG - Exonic
1083554738 11:63616975-63616997 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1083576557 11:63796110-63796132 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1084762863 11:71284919-71284941 CTTTCTAGGAAAAAGGAGAAGGG + Intergenic
1085149587 11:74239220-74239242 GTCTATAAGCAAGAGGAAAAAGG + Exonic
1085171708 11:74455114-74455136 TTGTATAATAAAAGGAAAAAAGG - Exonic
1085175000 11:74478239-74478261 CTCAAAAAGAAAAAAGAAAATGG - Intergenic
1085474635 11:76782235-76782257 ATGAATAAGAAAAAGTAATAAGG + Intronic
1085794064 11:79520577-79520599 CTGTCTATGAAAGAGGAAACTGG + Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086158712 11:83696509-83696531 CTTGATATGAAAAAGCAAAATGG + Intronic
1086559705 11:88153909-88153931 CTTTATATCAAGAAGGAAAATGG + Intronic
1086862077 11:91936226-91936248 CTGAATGAAAAAAAGGGAAAAGG + Intergenic
1087659313 11:100967717-100967739 CTGTCTCAAAAAAAAGAAAAGGG - Intronic
1087993492 11:104775109-104775131 CACTATAAGAAAAAGATAAAAGG + Intergenic
1088255016 11:107895410-107895432 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1088489707 11:110375082-110375104 CTGTTTAAGACAGAGGAAATTGG + Intergenic
1088629222 11:111758183-111758205 TTTTATAAGAAAAAAGAAATAGG - Intronic
1088656024 11:112000689-112000711 CTGTCTAAAAAAAAAAAAAAGGG + Intronic
1089991691 11:122867388-122867410 TTCTATAAGGAAAATGAAAAAGG - Exonic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1090924497 11:131237480-131237502 GTGTATAGGAAAAGGGAAAGAGG + Intergenic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1091575260 12:1727853-1727875 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1091639408 12:2223683-2223705 CTCTATAAGAGGAAGGATAATGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091690974 12:2597207-2597229 CTGCAAAACAAAAAGGAACAGGG - Intronic
1092022426 12:5213615-5213637 CTTTCTAAGAAAAAGGTTAAAGG + Intergenic
1092187552 12:6492366-6492388 TTGTATCCGAAAGAGGAAAATGG - Exonic
1092646019 12:10572824-10572846 CTTTAAATGAAAAAGGAAAGAGG + Intergenic
1093253580 12:16838303-16838325 AATTATAAGAAAGAGGAAAATGG + Intergenic
1093507049 12:19879788-19879810 GTGAAAAAGAAAAAGAAAAAGGG - Intergenic
1093791106 12:23251347-23251369 CTTTAAAAGAAAAAAGATAAAGG + Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1094105798 12:26810221-26810243 CTTTATAAGAAAACTAAAAAAGG - Intronic
1094443580 12:30506037-30506059 CTGTCTAAAAAAGAGGAAAATGG - Intergenic
1094479215 12:30868045-30868067 CTGTTTCAGAAAATAGAAAAAGG - Intergenic
1094501201 12:31022562-31022584 CTATTACAGAAAAAGGAAAAGGG + Intergenic
1094555056 12:31490763-31490785 TTGTAAGAGTAAAAGGAAAAAGG - Intronic
1094570516 12:31637466-31637488 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
1094749084 12:33384487-33384509 CTGTGGAAGAAAAATGATAAGGG - Intronic
1095044388 12:37484880-37484902 CTGTCTCAAAAAAAAGAAAATGG - Intergenic
1095173145 12:39058431-39058453 CCTTTTAAGAAACAGGAAAAAGG - Intergenic
1095743348 12:45630776-45630798 CTGTCTAAGAAAAAAAAAAGGGG + Intergenic
1096211533 12:49769889-49769911 GTGTAAAAGGAAAAGAAAAAGGG + Intergenic
1096308795 12:50502470-50502492 CTGTCTAAAAAAAAAAAAAACGG + Intergenic
1096400073 12:51298716-51298738 TTGTACAATAAAAAGAAAAAAGG + Intronic
1096639530 12:52982984-52983006 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1096739885 12:53685350-53685372 GTGTATGAGATAAAGGAGAAGGG + Intergenic
1097382597 12:58912828-58912850 TTGTAAAAGACAAAGAAAAAAGG + Intronic
1097406495 12:59196454-59196476 CTGTATTAAAAAAAGAAAAAAGG - Intergenic
1097692540 12:62746954-62746976 CTGTCTCAAAAAAAGAAAAAAGG - Intronic
1097972321 12:65647529-65647551 CGGCAGAAGATAAAGGAAAATGG + Intergenic
1098002749 12:65962355-65962377 AGGAATCAGAAAAAGGAAAAGGG + Intronic
1098129971 12:67340049-67340071 CTTTATAAGGAAAGGGAGAAAGG + Intergenic
1098276285 12:68814930-68814952 CTGGAGAGGAAAAAGAAAAATGG - Intronic
1098414465 12:70216916-70216938 ATGTAAAAGCAAAAGGAAATGGG + Intergenic
1098712977 12:73790544-73790566 CTTCAGAAGAAAAAAGAAAATGG - Intergenic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1099751246 12:86775708-86775730 CTTTGAAAGAAAAAGGATAATGG + Intronic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1099994823 12:89767172-89767194 CTTTATAAAAAAAAAAAAAAAGG + Intergenic
1100031541 12:90198462-90198484 CTGTATCAGAACAAACAAAATGG - Intergenic
1100058874 12:90547290-90547312 CTTTAAAAGGAAAAGTAAAAAGG + Intergenic
1100435736 12:94569933-94569955 GTGTATAACAAAGAGGAAGATGG - Exonic
1100878923 12:98994774-98994796 CCTTATAAGAAAGAGGAAATTGG - Intronic
1100879845 12:99004574-99004596 CTGTTTGAGAAAAATGAGAAAGG + Intronic
1101041334 12:100758915-100758937 TTGTATAAGAGACAGAAAAAGGG - Intronic
1101047634 12:100826613-100826635 CAGTGTAAGATAAAGGAACAGGG - Intronic
1101483479 12:105127106-105127128 CTGAAACAGAAAAGGGAAAAGGG - Intronic
1101604326 12:106236562-106236584 CTTTAAAATAAAAAGTAAAATGG + Intergenic
1101666216 12:106818086-106818108 TTGTATAATATCAAGGAAAAAGG + Intronic
1101715608 12:107309380-107309402 CTGTTTAAAAAAAAAAAAAATGG - Intergenic
1101732997 12:107441933-107441955 CTGTCTCAGAGAAAAGAAAAAGG + Intronic
1101880312 12:108621892-108621914 CTGTTAAAGAAAAAAAAAAATGG - Intergenic
1102071874 12:110026875-110026897 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1102115857 12:110402738-110402760 CTGTCTCAAAAAAAGGAAACGGG - Intronic
1102235027 12:111289116-111289138 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1102689560 12:114749779-114749801 CAGCAGAAGAAAAAAGAAAAGGG + Intergenic
1102717212 12:114984595-114984617 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1102840433 12:116114098-116114120 ATGTTTAAAAAAAAGGAAAAGGG - Intronic
1103124049 12:118406047-118406069 CAGTATAAGACCAAGGCAAAGGG - Intronic
1103241536 12:119417439-119417461 AAGTAAGAGAAAAAGGAAAAAGG - Intronic
1103595066 12:122020370-122020392 CTGTCTCAGAAAAAAAAAAAAGG - Exonic
1103627845 12:122234276-122234298 CTCAAAAAGAAAAAGAAAAAGGG - Intronic
1104243929 12:127018549-127018571 CTGTATCACTAAAATGAAAAAGG - Intergenic
1105374797 13:19833978-19834000 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1105374888 13:19834693-19834715 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1105750625 13:23419583-23419605 CAATATAAGAAAAGAGAAAAAGG - Intronic
1105796182 13:23855758-23855780 CAGTAAAAGAACCAGGAAAAGGG - Intronic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106061028 13:26292233-26292255 CGGTGTAAGAATAAGGTAAAAGG - Intronic
1106289264 13:28345444-28345466 CTTTATCCGAAAAATGAAAAGGG - Exonic
1106297805 13:28433787-28433809 CTGCAGAAGAAATAGAAAAATGG + Intronic
1106421339 13:29588847-29588869 CTGAAAAAGAAAAGGGGAAAAGG + Intronic
1106435181 13:29717226-29717248 CTGTAAAAGCAAAAGAACAAAGG - Intergenic
1106441226 13:29773614-29773636 CTGTATAAGATAATGAAACATGG - Intronic
1106800236 13:33248751-33248773 CTGAATAAGGGAAAGGATAATGG - Intronic
1107172674 13:37361605-37361627 CAATATAAGCAAAAGGATAAAGG + Intergenic
1107200389 13:37708833-37708855 ATGTATACGGAGAAGGAAAAAGG - Intronic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1107492637 13:40896033-40896055 CTTTTTAAAAAAAAGGTAAAGGG + Intergenic
1107523168 13:41203413-41203435 CTCTATAAAAAAAAAAAAAAGGG - Intergenic
1107589609 13:41888658-41888680 TTGCATAAGATAAAGTAAAAGGG - Intronic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1107951810 13:45469098-45469120 TTGTATTAGAACAAGGAAACAGG + Intronic
1108012472 13:46032920-46032942 TTATCTAAGAAAAAGAAAAAAGG + Intronic
1108030664 13:46225986-46226008 CTGTCAAAAAAAAAAGAAAAAGG - Intronic
1108271779 13:48768588-48768610 AAGGATAAGAAAAAGAAAAAGGG - Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108507184 13:51123044-51123066 CTGGATAAGATCAAAGAAAACGG - Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109291812 13:60485157-60485179 CTCATTAATAAAAAGGAAAATGG - Intronic
1109347512 13:61133309-61133331 CTTGAAATGAAAAAGGAAAATGG + Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1109498738 13:63210761-63210783 CTATATAAGATAAACTAAAATGG - Intergenic
1109578634 13:64295969-64295991 TTGTAAAAGAAAGAGGAAATTGG + Intergenic
1109691423 13:65895816-65895838 ATGTATAAGTAAATGGAAAAAGG - Intergenic
1109936519 13:69292931-69292953 CTGTAGAAGCAAAAGAGAAAAGG + Intergenic
1109976152 13:69835196-69835218 CTGTAGAATAAAAGAGAAAAAGG + Intronic
1109996397 13:70133100-70133122 CTGTATCAGAAATAGGATGAAGG + Intergenic
1110112970 13:71773970-71773992 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1110245599 13:73320200-73320222 CAATATAACAAAAAAGAAAACGG + Intergenic
1110407217 13:75164272-75164294 CTGTATATCAAAAAGTAAATAGG + Intergenic
1110477718 13:75937121-75937143 CTGTATCCAAAAAAAGAAAAAGG - Intergenic
1110780373 13:79458832-79458854 CTTTCTCAGAAAAGGGAAAAGGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111062699 13:83044244-83044266 TAGTATAAGTAAAGGGAAAATGG + Intergenic
1111116138 13:83780015-83780037 CTGCATAGGAAAAAGGAGATGGG - Intergenic
1111484538 13:88879581-88879603 CTGTCTAAAAAAAAGAAAAAAGG - Intergenic
1111578695 13:90194004-90194026 CTGAATAAGAAAAAGAATAGCGG - Intergenic
1111649643 13:91073292-91073314 CTTTAAAAGAGAAAGAAAAAAGG + Intergenic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1112000756 13:95207596-95207618 CTGTTTAAGAACATGGTAAATGG + Intronic
1112107549 13:96258191-96258213 CTTTAAATGAAACAGGAAAATGG + Intronic
1112381286 13:98893005-98893027 CTGAGAAAGACAAAGGAAAAGGG + Intronic
1112510756 13:100007126-100007148 AAGTATAAGAATAAGCAAAAAGG + Intergenic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1112629208 13:101141834-101141856 CACTATAAGCAAAAGAAAAAGGG + Intronic
1112798274 13:103081514-103081536 CTGTATAAGGTAAAGGGCAAAGG + Intergenic
1112925361 13:104667404-104667426 CTGTATAACAAAAAGAACATTGG - Intergenic
1113124759 13:106964887-106964909 CTCTAAAAGAAAAAAAAAAAAGG + Intergenic
1113157477 13:107340175-107340197 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
1113315620 13:109176467-109176489 ATGAATAAAAAAAAAGAAAACGG - Intronic
1113506102 13:110817069-110817091 CTGTTTAAGGAAAAAGAATAAGG + Intergenic
1113599302 13:111557462-111557484 CTGTAAATAAAACAGGAAAATGG + Intergenic
1113643859 13:111978447-111978469 CAGTAAAATAGAAAGGAAAAAGG + Intergenic
1113748283 13:112761299-112761321 CTTAATAAGGAAAAAGAAAATGG + Intronic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114151582 14:20046202-20046224 CTTGATAAGAAAAAATAAAAAGG - Intergenic
1114231774 14:20789748-20789770 ATGTAAAAGAGAAAGGGAAAGGG - Intergenic
1114468814 14:22944479-22944501 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1115005843 14:28483587-28483609 CTGTAAAGTAAAAAGGAAATTGG + Intergenic
1115449893 14:33535334-33535356 TAGTATAAGAAACAGTAAAATGG + Intronic
1115540303 14:34413250-34413272 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1115552108 14:34513881-34513903 CTGTCTCAGAAAAAAAAAAATGG - Intergenic
1115566339 14:34628774-34628796 ACGGATAAGAAAAAGCAAAAGGG + Intronic
1115759551 14:36565682-36565704 CTGTATCAAAAAAAAGAAAAAGG - Intergenic
1116115078 14:40637657-40637679 TTGTTTAAAAAAAAGGCAAATGG - Intergenic
1116262729 14:42652469-42652491 CTGTAAAAGATAAAAGAAATGGG + Intergenic
1116459549 14:45156617-45156639 TGGTATAAGAAAAAGGGAATTGG + Intronic
1116900522 14:50358067-50358089 TTGTCCAAGAAAAAGAAAAAAGG - Intronic
1117142206 14:52800534-52800556 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1117354813 14:54913524-54913546 TTGAAAAAGAAAAAGAAAAATGG + Intergenic
1117392734 14:55277842-55277864 CTGAATAAGCCAAAGTAAAAAGG - Intronic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1118092849 14:62501662-62501684 CTCTAAGAGAAAATGGAAAAGGG - Intergenic
1118559122 14:67058933-67058955 CTCAATAAGAAAAAGGCTAAGGG + Intronic
1118843807 14:69531116-69531138 CTGTCTCAGAAAAAAAAAAAAGG + Exonic
1118916176 14:70108420-70108442 ATGAAAAAGAAAAAAGAAAAAGG + Intronic
1119109206 14:71955898-71955920 CCCCATAAGAAAAAGGAAGATGG + Intronic
1119963983 14:78892549-78892571 CTGGGTAAGAAAAAAAAAAAAGG - Intronic
1120035993 14:79698996-79699018 CTGCTCAAGGAAAAGGAAAAAGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120404073 14:84072145-84072167 TTGTTTTACAAAAAGGAAAATGG - Intergenic
1120520834 14:85526589-85526611 AAGAAAAAGAAAAAGGAAAAAGG - Intergenic
1120571470 14:86122534-86122556 TTATATATGAAAAAAGAAAATGG + Intergenic
1120706032 14:87746740-87746762 GTTTATAAAAAACAGGAAAAGGG + Intergenic
1120834098 14:89025469-89025491 CTGTTCAAGAGAAAGAAAAAAGG - Intergenic
1120954484 14:90069333-90069355 CTGTTTAATAAAAATGAATAGGG - Intronic
1121116227 14:91344799-91344821 CTGTATCAGAAAAAAAAAAAAGG - Intronic
1121477647 14:94225866-94225888 ATCTATAAGAAAGAGGAAACAGG - Intronic
1121593299 14:95137291-95137313 AGGCAAAAGAAAAAGGAAAAGGG + Intronic
1121593837 14:95143365-95143387 CTGGAAAAGAAAAGGGGAAAGGG - Intronic
1121905162 14:97733693-97733715 TTCTCTTAGAAAAAGGAAAAAGG - Intergenic
1122010098 14:98739167-98739189 CTGAAAAAAAAAAAAGAAAAAGG - Intergenic
1122391568 14:101391386-101391408 CTGTATAAGAAATGTTAAAAGGG - Intergenic
1122405050 14:101495821-101495843 ATGTTAAAGAAAAAGGTAAAAGG + Intergenic
1122570925 14:102700225-102700247 CTGTCTCAAAAAAAGAAAAAGGG - Intronic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1122663508 14:103313244-103313266 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1123009274 14:105339504-105339526 CTCTATAAAAAAAAAAAAAAAGG + Intronic
1123463968 15:20500301-20500323 TGTTATAAAAAAAAGGAAAAGGG - Intergenic
1123654096 15:22500120-22500142 TGTTATAAAAAAAAGGAAAAGGG + Intergenic
1124227721 15:27909454-27909476 CTGAAAAAGAAAAACTAAAAAGG + Intronic
1124308002 15:28595318-28595340 TGTTATAAAAAAAAGGAAAAGGG + Intergenic
1124623058 15:31289812-31289834 ATGGATAAGATAAAGGTAAAAGG - Intergenic
1125398352 15:39273839-39273861 TTGAAAAAGAAAAAGAAAAATGG - Intergenic
1125452667 15:39825195-39825217 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1125494734 15:40181649-40181671 CTGAAAAACAAAAAGAAAAATGG - Intronic
1125499414 15:40229820-40229842 CTTAATAGGAAAAAGGAAAGGGG + Intergenic
1125517440 15:40330265-40330287 GCTTATAAGAAAAGGGAAAAAGG + Intergenic
1125623934 15:41090569-41090591 CTGTCCAAAAAAAAGAAAAAAGG + Intronic
1126053524 15:44708897-44708919 CTCAAAAAGAAAAAAGAAAAAGG - Intronic
1126220829 15:46210640-46210662 ATGTAAAATAAAAAGGAAATGGG + Intergenic
1126235684 15:46381529-46381551 CTGTATAAGACAGAGGGGAAAGG + Intergenic
1126282277 15:46967737-46967759 CTATATAGGTAAACGGAAAAGGG + Intergenic
1126310444 15:47310010-47310032 CTGTACAAGAAAAGGGAACATGG + Intronic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1126921760 15:53534445-53534467 ATTTATGAGAATAAGGAAAAGGG - Intronic
1127167673 15:56264073-56264095 TTACACAAGAAAAAGGAAAATGG - Intronic
1127217529 15:56839558-56839580 CTGTATAAGAACTATGAACATGG - Intronic
1127831942 15:62758710-62758732 CTTTAGAAGGAAAAGGAAAAAGG + Intronic
1128923873 15:71636416-71636438 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1129052450 15:72793799-72793821 CTGTGTAAGAAAAAAAAAAATGG - Intergenic
1129285363 15:74520198-74520220 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1129544846 15:76384890-76384912 GTTTATAAGAAAAAAGTAAAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129745791 15:78019882-78019904 CTGTATCAAAAAAAAAAAAAGGG + Intronic
1129922099 15:79328356-79328378 CTTTATAAATTAAAGGAAAATGG - Intronic
1130161554 15:81406145-81406167 TTGTTTAAAAAAAAAGAAAAAGG + Intergenic
1130178604 15:81601901-81601923 CTAAATAAGAACATGGAAAATGG + Intergenic
1130208614 15:81901933-81901955 CTTTATAAGAAAGAGGAGAAAGG + Intergenic
1130372379 15:83296030-83296052 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131010448 15:89013065-89013087 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1131659749 15:94501184-94501206 CTGTAAAAAAAAAAAAAAAAAGG - Intergenic
1131665249 15:94564641-94564663 CTATGCAAGAAAAAAGAAAAAGG + Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1132225325 15:100136310-100136332 CAGCTTAAGAAAAAAGAAAACGG + Intronic
1132272856 15:100541510-100541532 CTTAATAAGGAAAAGGAAACTGG + Intronic
1132650207 16:1017927-1017949 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1133103061 16:3490818-3490840 CTGTCTCAAAAAAAAGAAAAGGG + Intergenic
1133799289 16:9072020-9072042 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1134264088 16:12677634-12677656 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1134421938 16:14101270-14101292 CACTATAAGAAAAAGGACATAGG - Intronic
1134500894 16:14768413-14768435 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134579688 16:15360636-15360658 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134634215 16:15779830-15779852 CTGTTGAGGAAACAGGAAAAGGG - Intronic
1134670388 16:16050452-16050474 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1134715016 16:16353562-16353584 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1134722894 16:16396923-16396945 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1134747524 16:16599610-16599632 CTGTCTCAGAAAAAAGAAAATGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134944534 16:18314948-18314970 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134951799 16:18355097-18355119 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134997946 16:18754047-18754069 CTGTCTCAGAAAAAAGAAAATGG + Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135535854 16:23293917-23293939 CTGTCTTAAAAAAAGAAAAATGG + Intronic
1135563633 16:23495200-23495222 AATTTTAAGAAAAAGGAAAAGGG - Intronic
1135639288 16:24106833-24106855 GTCAATAAGAAAAAGGCAAAAGG - Intronic
1135716445 16:24773011-24773033 CTTTATTAAAAAAATGAAAATGG - Intronic
1135817746 16:25651227-25651249 CTGTAAGAAAATAAGGAAAAGGG - Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135873658 16:26176757-26176779 CTATATTAGAAAATGGGAAAGGG - Intergenic
1136165961 16:28453303-28453325 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136197011 16:28661717-28661739 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136213350 16:28775840-28775862 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136258082 16:29055757-29055779 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136320412 16:29480552-29480574 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136358745 16:29763886-29763908 CTCTAAAAAAAAAAGGAAAAAGG + Intergenic
1136413328 16:30089628-30089650 CTGTCTCTGAAAAATGAAAAAGG + Intronic
1136434985 16:30219892-30219914 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136454783 16:30374308-30374330 CTGTCTAAAAAAAAAAAAAAGGG + Intronic
1136779668 16:32888732-32888754 CTGTATAAGAAACATAAAATGGG - Intergenic
1136890948 16:33972786-33972808 CTGTATAAGAAACATAAAATGGG + Intergenic
1137038280 16:35586277-35586299 ATGTATAGGACAAAGGAAAAAGG + Intergenic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137329855 16:47482446-47482468 CTGTATAATTAAAATGAATATGG - Intronic
1137337131 16:47560934-47560956 TGGTATAAGGAAAAGGAAAATGG + Intronic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137789213 16:51160656-51160678 AAGTATAATAACAAGGAAAAAGG - Intergenic
1138095066 16:54205092-54205114 CTGAATAAGTGAACGGAAAATGG + Intergenic
1138278944 16:55758120-55758142 CTCTACAAGAATAAGGAGAAAGG - Intergenic
1138289590 16:55835554-55835576 CTCTACAAGAATAAGGAGAAAGG + Intergenic
1138622844 16:58225465-58225487 CTGTTTCAGAAAAAAAAAAAAGG + Intergenic
1138855389 16:60685279-60685301 ATTTGTAAGAAAAAAGAAAATGG + Intergenic
1139025462 16:62811995-62812017 TTATTTAAGAAAAAGAAAAAAGG + Intergenic
1139254257 16:65526134-65526156 AGGCAAAAGAAAAAGGAAAAAGG + Intergenic
1139325708 16:66151342-66151364 ATGAGGAAGAAAAAGGAAAAAGG + Intergenic
1139361213 16:66401382-66401404 CTATTTTTGAAAAAGGAAAAAGG + Intronic
1139419404 16:66841040-66841062 CTTTAAAAAAAAAAGAAAAAAGG + Intronic
1139498422 16:67339256-67339278 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1139554701 16:67699803-67699825 CTGAAAAAGAAAAAAAAAAAAGG + Intronic
1139710368 16:68771287-68771309 CTTAAAAAGAAAAAGAAAAAAGG - Intronic
1139819136 16:69706202-69706224 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1139871594 16:70112912-70112934 CTGTCTAAAAAAAGAGAAAACGG - Intergenic
1139903837 16:70348937-70348959 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1140201472 16:72898258-72898280 ATTTATAAGAAAAAAGTAAAAGG + Intronic
1140364341 16:74369574-74369596 CTGTCTAAAAAAAGAGAAAACGG + Intergenic
1140553940 16:75898281-75898303 ATTTTTAAGAAAAAGGAAGATGG - Intergenic
1140975088 16:80052393-80052415 GTATATAAGAAAAAAGAAATAGG - Intergenic
1141031158 16:80590127-80590149 CTGTCTCAGAAAAAGAAAACGGG + Intergenic
1141061195 16:80872707-80872729 CTGTATTTTAAAAAGGAAAAGGG + Intergenic
1141515450 16:84541331-84541353 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
1141571668 16:84937912-84937934 CTGTGCAAGAAAAAATAAAATGG - Intergenic
1142067180 16:88069299-88069321 GTGGAAAAGAAAAAAGAAAAAGG - Intronic
1142069361 16:88082499-88082521 CTCTATCAAAAAAAGAAAAAAGG + Intronic
1203082086 16_KI270728v1_random:1150820-1150842 CTGTATAAGAAACATAAAATGGG - Intergenic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1142829117 17:2534360-2534382 CTGGTTAAGAAAAAGACAAAAGG + Intergenic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1143920845 17:10329993-10330015 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
1144018550 17:11220335-11220357 CTTTATTACAAAAAGGGAAACGG - Intergenic
1144167220 17:12624868-12624890 CTGTCTAAAAAAAAAGGAAAAGG + Intergenic
1144335995 17:14269404-14269426 ATGAAAAAGAAAAAAGAAAAGGG - Intergenic
1145012212 17:19375735-19375757 CAGTATCAGAAAAAGAAAAGAGG + Intronic
1145875412 17:28315445-28315467 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1145985340 17:29042400-29042422 CTCTTTGAGAAAAAGAAAAAAGG - Intronic
1146346804 17:32065499-32065521 CTGTATTAAAAAAAAAAAAATGG - Intergenic
1147045234 17:37746340-37746362 CTGTAGAAGAACAGGGAAAGGGG + Intergenic
1147151253 17:38515794-38515816 CTGTATTAAAAAAAAGAAAGAGG + Intergenic
1147277700 17:39332964-39332986 TTAAAAAAGAAAAAGGAAAAAGG - Intronic
1147284166 17:39387942-39387964 CTGTATTATAAAAACTAAAAAGG + Intronic
1147735795 17:42637292-42637314 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1147908454 17:43839322-43839344 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1147990782 17:44331755-44331777 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1148710114 17:49673658-49673680 CATTATACGAAAAAAGAAAAAGG + Intronic
1148884293 17:50760323-50760345 CCGTCTCAGAAAAAGAAAAAAGG + Intergenic
1149250644 17:54765038-54765060 TTGGAAAAGAAAAAGGAAACAGG + Intergenic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150168640 17:62967646-62967668 CTGTGTAAAAATCAGGAAAAGGG - Intergenic
1150644386 17:66968807-66968829 CTGAAAGAGAAAGAGGAAAAGGG - Intronic
1150758237 17:67935421-67935443 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1150992004 17:70270544-70270566 TTCCATAAGAAAAAGGAAATGGG + Intergenic
1151151579 17:72092433-72092455 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1151409877 17:73915546-73915568 CTGAAAAAGAAAAAGGAAAGGGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152098585 17:78287605-78287627 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1152370543 17:79885773-79885795 CTGGAAAGGAAAAAGTAAAATGG - Intergenic
1153026005 18:673075-673097 CTCTAAAAGAAAAAGGAACTAGG + Exonic
1153037044 18:773423-773445 CCATATAAGAAATAGGAAAGGGG - Intronic
1153629110 18:7052424-7052446 CTGTATCAAAAAAAAAAAAATGG + Intronic
1153657855 18:7301333-7301355 CCATCTAAGAAAAATGAAAAAGG - Intergenic
1153822182 18:8841605-8841627 CTGAAGCAGAAAAAGGAATATGG - Intergenic
1154004804 18:10517960-10517982 CTGTATACTAGAAAGAAAAATGG - Intergenic
1154282770 18:13021222-13021244 TTGTGAAAGAAAAAGAAAAAAGG + Intronic
1154424490 18:14261633-14261655 CTGTAAAAAAAAAAGCACAATGG + Intergenic
1154481359 18:14829397-14829419 TTGAATAATAGAAAGGAAAAGGG + Intronic
1155278769 18:24216504-24216526 CTCCAGAAGAAAAAAGAAAAAGG + Intronic
1155283687 18:24267087-24267109 CAGTATTAGAAAAAAGAAAATGG + Intronic
1155605652 18:27602603-27602625 CTATATCAGAAAAATAAAAATGG + Intergenic
1155983957 18:32209996-32210018 GAGAATATGAAAAAGGAAAATGG - Intronic
1156124857 18:33891677-33891699 ATTGATGAGAAAAAGGAAAAAGG + Intronic
1156383000 18:36580904-36580926 CTGTATAAGGCAAAGGCAACTGG - Intronic
1156689429 18:39688958-39688980 CTCTAGAAGAAAAAGAAAGAAGG + Intergenic
1157060214 18:44279248-44279270 CAGGAAAAGAACAAGGAAAAAGG + Intergenic
1157105990 18:44774916-44774938 CTGACTAAGGAAAAAGAAAAAGG - Intronic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1157253575 18:46117646-46117668 CTCTATAAGAAAAAATAAACCGG + Intronic
1158072251 18:53486774-53486796 CTGCAAAAGAAAAAGGTTAATGG - Intronic
1158172256 18:54613235-54613257 ATGTCTAAGAAAAAGCATAATGG - Intergenic
1158613227 18:58962219-58962241 CTGTCTAAAAAAAAAAAAAATGG + Intronic
1159749846 18:72286677-72286699 CTGAATAAGAAATAAGAAAGAGG + Intergenic
1160734565 19:656645-656667 CAGAAAAAGAAAAAGAAAAAGGG + Intronic
1161023834 19:2025575-2025597 CTGTCTCAGAAAAAAAAAAAAGG - Intronic
1162090405 19:8276058-8276080 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162092638 19:8290891-8290913 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162456381 19:10787464-10787486 CTGTTTAAAAAAAAGAAAAAAGG + Intronic
1162715895 19:12633141-12633163 ATGTTTAATAAAAAGGAAAATGG - Intronic
1162727301 19:12697523-12697545 CCGTCTCAGAAAAAAGAAAAAGG - Intergenic
1162987690 19:14281644-14281666 CTGTCAAAAAAAAAAGAAAAAGG - Intergenic
1164382497 19:27746815-27746837 CAGAATAACAAAAAGGAAACGGG + Intergenic
1164620088 19:29690282-29690304 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1165370524 19:35402785-35402807 CTCAAAAAGAAAAAAGAAAAAGG - Intergenic
1165381028 19:35480480-35480502 CTGTAGAAAAAAAGGGAAAGGGG - Intergenic
1165474171 19:36020081-36020103 CTCTATAAAAGAAAGAAAAAAGG + Intronic
1165587835 19:36935991-36936013 ATGGAAAACAAAAAGGAAAATGG - Intronic
1165847561 19:38828233-38828255 CTGTCTCAAAAAAAAGAAAACGG - Intronic
1166462524 19:43001674-43001696 CTCTAAAAGAAAAAAAAAAAAGG + Intronic
1166580842 19:43897575-43897597 CTGCATATGAAAAAAGAAATGGG + Intronic
1166613150 19:44218110-44218132 ATGTGTATGAAAAAGGAACATGG - Intronic
1166773624 19:45299408-45299430 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1166825008 19:45603080-45603102 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1167075523 19:47246345-47246367 CTGTCTAAAAAAAAAGAAAAAGG - Intergenic
1167816334 19:51884243-51884265 CTGTAAAAGAAAAAACAAAAAGG + Intronic
1168150403 19:54444384-54444406 CTGATTAAAAAATAGGAAAAGGG + Intergenic
925056565 2:861287-861309 CTGAGTAACAAAAAGGGAAATGG - Intergenic
925357862 2:3254898-3254920 CTGTATCACAAACAGGAAACTGG - Intronic
925454385 2:4002855-4002877 CTGCAAGAGAAAAAGGAACAGGG - Intergenic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
925951610 2:8918548-8918570 TTGTTTAATAAAAAGAAAAAAGG + Intronic
926097334 2:10090483-10090505 CTGAAGAAGAAAAAGAACAAGGG - Intergenic
926203261 2:10816413-10816435 CTGTAAAAAAGAGAGGAAAATGG - Intronic
926271073 2:11366460-11366482 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
926828654 2:16935631-16935653 CTGTATGAGATAATGGAAACTGG + Intergenic
927304425 2:21554283-21554305 CTTTATCAGCAAAATGAAAATGG + Intergenic
927489750 2:23513247-23513269 TTGTTTAAGAAAAAAGAAATTGG - Intronic
927915760 2:26935173-26935195 GTGCAGAAGAAAAAGGGAAAGGG - Intronic
928172767 2:29014024-29014046 CAGGAAAAGAAAAAGCAAAATGG - Intronic
928614070 2:33018865-33018887 CTCTAAAAGAAAAAAAAAAATGG - Intronic
928629745 2:33178903-33178925 CTAAAGAAGAAAAAGAAAAAAGG - Intronic
928820076 2:35351132-35351154 ATGTATAAGAGAAAGCAATAAGG - Intergenic
928927552 2:36594804-36594826 GGCTATAAGAAAAAGGCAAATGG + Intronic
928968461 2:37001094-37001116 CTGTGTAATGAAAACGAAAAAGG + Intronic
929059635 2:37910469-37910491 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929883221 2:45855291-45855313 GTGTATGAAATAAAGGAAAAGGG + Intronic
930291845 2:49504079-49504101 GTGTTTAAGAAAAATTAAAATGG - Intergenic
930491169 2:52074503-52074525 CTGCATTAGAAACAGGAAGAAGG + Intergenic
930491377 2:52076639-52076661 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
930579567 2:53194342-53194364 CTTTATCAGAAACATGAAAATGG - Intergenic
930837595 2:55811153-55811175 CTGAAGAAAAATAAGGAAAATGG - Intergenic
930929940 2:56869023-56869045 CAAAAAAAGAAAAAGGAAAAAGG + Intergenic
931034170 2:58218401-58218423 CTGATTAAGAAAAATTAAAAAGG + Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931593362 2:63911161-63911183 CTGTATATCAAAAAGGAAACTGG + Intronic
932145996 2:69317804-69317826 CTTTATAAGGAAGAGGAAAATGG + Intergenic
932381255 2:71285399-71285421 CTGTTTAAAAAAAAGAAAATGGG - Intronic
932394658 2:71433453-71433475 CTGTTCAAGGAAAAGGAATAAGG - Intronic
932940952 2:76164557-76164579 TTGGAAAAAAAAAAGGAAAAAGG - Intergenic
933117276 2:78489969-78489991 AAGTTTAAAAAAAAGGAAAATGG + Intergenic
933169828 2:79112936-79112958 CTGAATGACAAAAAGGCAAAAGG + Intergenic
933241187 2:79922111-79922133 GTGATTAAGAAAACGGAAAAAGG - Intronic
934075052 2:88421167-88421189 ATGTATAAGAAAAAGCATAGTGG + Intergenic
934688356 2:96337929-96337951 CTGTCTCAGAAAAAAAAAAAGGG - Intronic
934748741 2:96777869-96777891 CTGTTTCAGAAAAAAAAAAAAGG - Intronic
935017695 2:99199878-99199900 CTTTATAATAAAAAGAAAAGAGG - Intronic
935042993 2:99452416-99452438 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
935547046 2:104411358-104411380 CTTTTAAAGAAAAAGAAAAATGG + Intergenic
936027028 2:109039710-109039732 TTTTAAAAGAAAAAGAAAAAAGG - Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936690124 2:114877235-114877257 CTGATTAAGAAAGAAGAAAAAGG + Intronic
937109557 2:119353520-119353542 CATTATAATAAAAAGAAAAAAGG + Intronic
938172883 2:129097378-129097400 CCCTATAAGAAATACGAAAATGG - Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938532116 2:132198621-132198643 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
938747804 2:134296571-134296593 CTTTATAAGACTAAGGAAAGTGG - Intronic
938757234 2:134391984-134392006 GTCTATAAGAAAAAGGGAGAAGG - Intronic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939780048 2:146434738-146434760 GTGTAGAAGAAAATGGAAAGAGG - Intergenic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940082028 2:149813754-149813776 CTGTATAAGGAATAGGTGAAAGG + Intergenic
940340558 2:152576636-152576658 CTGTAGAAAAAATAGGAAATAGG + Intronic
940528408 2:154845963-154845985 CTGTCTCAGAAAAAAAAAAAAGG + Intronic
940563097 2:155326427-155326449 CTGTCTCACAAAAAAGAAAATGG + Intergenic
940626519 2:156182079-156182101 CTGTTTCTGAACAAGGAAAATGG + Intergenic
940822104 2:158367215-158367237 TTGTGTTATAAAAAGGAAAAAGG - Intronic
941031071 2:160512336-160512358 CCTTATAAGAGAAAGGCAAAGGG - Intergenic
941342298 2:164322473-164322495 CTTTAAAAAAAAAAGGTAAAAGG - Intergenic
941795897 2:169598003-169598025 CTGTATCAAAAAAAAAAAAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941961618 2:171259589-171259611 CTCCAAAAGAAAAAGGAAAAAGG + Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942253615 2:174069379-174069401 CTGTACAAGAAAATGAATAATGG + Intergenic
942377412 2:175352029-175352051 CTCTATAAGAGAAAGGCAGAGGG - Intergenic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
942412383 2:175724158-175724180 ATGAAACAGAAAAAGGAAAATGG + Intergenic
942536641 2:176971753-176971775 AGGTAAAAGAAAAAGAAAAAGGG - Intergenic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
942581891 2:177428459-177428481 CTAAATATGAAAAAGAAAAATGG - Intronic
942700359 2:178700807-178700829 ATGTATAACAAAAAGAATAATGG - Intronic
943364659 2:186957806-186957828 CTGTCTAGAAAAAAGAAAAAAGG + Intergenic
943377485 2:187097692-187097714 TTGTATAGTAAAGAGGAAAATGG - Intergenic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944727494 2:202485844-202485866 CCTTATAAGATAAAGGCAAAGGG - Intronic
944789351 2:203108725-203108747 GTGTAAAAGTGAAAGGAAAAAGG + Intronic
944790259 2:203117640-203117662 TTAGATAAGTAAAAGGAAAAAGG + Intronic
944996581 2:205301589-205301611 AAGGAGAAGAAAAAGGAAAAGGG + Exonic
945013778 2:205492668-205492690 CTTTATAAGAAATGGGAAACGGG + Intronic
945103110 2:206281778-206281800 CTGAAAAACAAAAAGAAAAATGG - Intronic
945132661 2:206590504-206590526 CTTTAGAAGGAAAAGGAAAGAGG - Intronic
945284456 2:208068613-208068635 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
945761990 2:213924964-213924986 CAGTATAAGAAAAAAAGAAATGG - Intronic
945874966 2:215268282-215268304 GAGAAAAAGAAAAAGGAAAAAGG - Intergenic
946285555 2:218699926-218699948 CTGTCTCAGAAAAAAAAAAAAGG - Intronic
946646292 2:221838374-221838396 GAGTATGAGAAAAAGAAAAAAGG - Intergenic
946971329 2:225095200-225095222 CTGTCTAAGCAAAAAAAAAAAGG - Intergenic
947025540 2:225733808-225733830 CTTGATATGAAAAAGGAAAAGGG + Intergenic
947094662 2:226552125-226552147 CTGAATTAGAACAAGGAAACAGG + Intergenic
947242659 2:228013254-228013276 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
948249832 2:236517985-236518007 CAGTGTGAGAAAAAAGAAAAAGG + Intergenic
948451376 2:238076045-238076067 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
948623915 2:239255513-239255535 CTGTGTAAGAATAAAGACAAAGG - Intronic
948766283 2:240222712-240222734 CTGTATTAGAAAAGAAAAAAAGG - Intergenic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168778261 20:466349-466371 CTGTTTCAGATAAAGAAAAACGG - Intergenic
1169136130 20:3198809-3198831 CTGGAAAAGAAAAAGGATACTGG + Intronic
1169358835 20:4930396-4930418 CATTATAGGAAAAAAGAAAATGG + Intronic
1169416780 20:5424017-5424039 CTTTATAGGACCAAGGAAAAGGG - Intergenic
1169634395 20:7672183-7672205 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1169920643 20:10731044-10731066 AAATAAAAGAAAAAGGAAAAAGG - Intergenic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170193722 20:13669417-13669439 CAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1170298406 20:14854713-14854735 CTCTTTAAGAAAAAGACAAATGG + Intronic
1170333378 20:15240574-15240596 AAGAAGAAGAAAAAGGAAAATGG + Intronic
1170687370 20:18581634-18581656 GTGTGTATCAAAAAGGAAAATGG + Intronic
1170854001 20:20032485-20032507 CTTTAAAAGAAAAACAAAAAAGG - Intronic
1170985008 20:21249648-21249670 CTTTTTAAGAAGAAAGAAAAAGG - Intergenic
1171565114 20:26176014-26176036 CTATATAGTAAAAAGAAAAATGG + Intergenic
1172135462 20:32683784-32683806 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1172296256 20:33813140-33813162 CTGTAAAAAAAAAAAAAAAAGGG + Intronic
1172744544 20:37196531-37196553 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1173906002 20:46629653-46629675 CTGTATCAGACAGAGCAAAATGG - Intronic
1173956341 20:47035841-47035863 CTGAAAAAAAAAAAGAAAAAGGG + Intronic
1174008966 20:47433557-47433579 ATTTTTAAAAAAAAGGAAAAAGG + Intergenic
1174248871 20:49203035-49203057 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1174294559 20:49536339-49536361 ATATATAAGCAAAAGGAAATGGG + Intronic
1174701298 20:52611646-52611668 CTGTATAAGAAAGAAGGAGATGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175969815 20:62679364-62679386 GTGTATCAGAAAAAAAAAAAAGG - Intronic
1176799251 21:13407212-13407234 TTGAATAATAGAAAGGAAAAGGG - Intergenic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1176953604 21:15074086-15074108 CTGTATCAAAAAAAAAAAAAAGG - Intergenic
1177170392 21:17648786-17648808 CTTTATAAGAAAGAGGCAAGAGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177490400 21:21818125-21818147 CTCTAAAAGAAAAAGAAAATTGG - Intergenic
1177613206 21:23481514-23481536 CAGCAGAAGAAAAAGGAATAAGG + Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178196815 21:30354577-30354599 CAGTAAAGGAAAAAGGAAAGGGG - Intronic
1178484977 21:33013398-33013420 CTTTATAAGAGAAAGGCAGAGGG - Intergenic
1178515444 21:33243086-33243108 CTGTCTAAAAAAAAAAAAAATGG - Intronic
1179510322 21:41868674-41868696 AAGAAAAAGAAAAAGGAAAATGG - Intronic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1180745611 22:18086843-18086865 CTGAATAAGAGAAAGAGAAATGG - Intronic
1181321114 22:22007119-22007141 CTGTCTCAGAAAAAAAAAAAGGG - Intergenic
1181424672 22:22826486-22826508 CTGAATTCCAAAAAGGAAAAGGG - Intronic
1181643124 22:24215203-24215225 CTGTGGACCAAAAAGGAAAAGGG - Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181972006 22:26697981-26698003 CCATCTAAGAAAAAAGAAAAAGG - Intergenic
1182036156 22:27199944-27199966 GTGTATAAGAAAAACCAAACAGG - Intergenic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182436175 22:30331607-30331629 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1182757267 22:32690167-32690189 CTGTCTCAAAAAAAGGAAAAAGG + Intronic
1182877391 22:33704189-33704211 CTGTATAAAACAAAGGAATATGG + Intronic
1182902087 22:33906994-33907016 AAGCAGAAGAAAAAGGAAAATGG + Intronic
1182933904 22:34202058-34202080 GTCTAGAAGAAAAAGGAAATAGG - Intergenic
1182956205 22:34429026-34429048 CTTTATGTGAAAAATGAAAATGG + Intergenic
1183245898 22:36693139-36693161 CTGTCTAAAAAAAAGAAAAAAGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183872994 22:40754535-40754557 CTCTAAAAAAAAAAGAAAAAGGG + Intergenic
1184061008 22:42081463-42081485 CTGTCTAAAAAAAAGACAAAAGG - Intronic
1184687353 22:46102639-46102661 CTGTCCCTGAAAAAGGAAAACGG + Intronic
1184738599 22:46413637-46413659 ATGTAAAAGAAAAATGAAAAAGG - Intronic
1185132124 22:49045186-49045208 CTCGACAAGAAAAAGGAAGAGGG - Intergenic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
949226715 3:1703970-1703992 CTGAATAAAAAATAAGAAAAAGG - Intergenic
949233050 3:1774058-1774080 CTTTATAAAAGAAAGGCAAAAGG - Intergenic
949254739 3:2032358-2032380 CTGTATATGAACCAGGAAACAGG - Intergenic
949451933 3:4195502-4195524 CCGTTTAACAAAAAGGAAACTGG + Intronic
949465838 3:4342880-4342902 CTGTAGGAGAAAGAGGAAAGAGG - Intronic
949504322 3:4712794-4712816 TTGGATAAGAAAACAGAAAACGG + Intronic
949724484 3:7027547-7027569 CAGTAAAAGAAAAACAAAAAAGG - Intronic
949815208 3:8050957-8050979 CTGTATTTGAAAAAGACAAATGG - Intergenic
950160901 3:10760323-10760345 CTATATAGGAAAAATGAAATTGG + Intergenic
950220238 3:11189943-11189965 CTGTTTCAAAAAAAGAAAAATGG + Intronic
950598788 3:14012252-14012274 CTGTCTCAGAAAAAAAAAAAAGG - Intronic
950938153 3:16864355-16864377 CTGGAAACGAAAAGGGAAAATGG - Intronic
951100039 3:18676841-18676863 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
951172766 3:19561536-19561558 CCTTATAAGAAAGAGGAAAAAGG + Intergenic
951209484 3:19958932-19958954 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
951285458 3:20807231-20807253 CTGTAGAAAAAAAAAAAAAAAGG + Intergenic
951400869 3:22230287-22230309 CTATAAAAAAAGAAGGAAAATGG + Intronic
951535810 3:23739615-23739637 CTGTTTAAAAAAAAAAAAAAGGG + Intergenic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
951903863 3:27684168-27684190 CAGTATAAGAAAATGTGAAAAGG + Intergenic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952348360 3:32509884-32509906 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
952446409 3:33385022-33385044 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
952538244 3:34336604-34336626 GGGTGGAAGAAAAAGGAAAAGGG - Intergenic
952689831 3:36192211-36192233 CTGAATCAGAAATAAGAAAATGG - Intergenic
952856976 3:37780086-37780108 TTGGGTAAAAAAAAGGAAAAAGG + Intronic
952997627 3:38900344-38900366 CTGTTGAAGATAAAGCAAAATGG + Intronic
953094807 3:39765067-39765089 TTGTTTAAGAAAAAAAAAAAAGG - Intergenic
953245493 3:41187626-41187648 CTGAATGACAAAAAGAAAAAAGG + Intergenic
953629488 3:44600937-44600959 CTCTACAAAAAAAAAGAAAAAGG - Intronic
954268173 3:49486517-49486539 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
954467160 3:50662417-50662439 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
954881209 3:53837191-53837213 CTCTAAAAGAAAAAAAAAAAAGG + Intronic
954924744 3:54223429-54223451 CTGTATAGGAAAATGATAAATGG + Intronic
955743576 3:62118522-62118544 CTGATCTAGAAAAAGGAAAAAGG + Intronic
955871390 3:63442099-63442121 GTGTATAAGAAAAGGAAGAAAGG + Intronic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
956037155 3:65106237-65106259 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
956183023 3:66534992-66535014 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
956262259 3:67356947-67356969 CTGTAGTTGAAAAAGGAAAATGG - Intergenic
956425420 3:69129478-69129500 CTGTTTTAGAAAAAGTAAAATGG - Intergenic
957060285 3:75475901-75475923 GTCTAAAAAAAAAAGGAAAAAGG - Intergenic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957337108 3:78845382-78845404 CAATAAAAGGAAAAGGAAAAAGG - Intronic
957355307 3:79075872-79075894 CATTATAATAAAAATGAAAAGGG + Intronic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
957697133 3:83653713-83653735 AAGTATAAGAATAAGGAAAATGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
958637254 3:96761328-96761350 TCGTATAAATAAAAGGAAAATGG - Intergenic
958648580 3:96905345-96905367 AATTATAAGAAAAAAGAAAAAGG - Intronic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
958935236 3:100249615-100249637 CTGTAAAAGAAAAGAGAAATAGG - Intergenic
958974273 3:100648550-100648572 ATGTTTATGAAAAAGTAAAATGG + Intronic
959063714 3:101637242-101637264 GGGTATGAGATAAAGGAAAAAGG + Intergenic
959385837 3:105705372-105705394 CTGGAGAAGAAAAAGGACATTGG - Intronic
959452590 3:106522266-106522288 TTGGATAAGAAAAATAAAAAGGG - Intergenic
959588327 3:108047661-108047683 CTGTAGATGAAAGAGAAAAATGG + Intronic
959627420 3:108468319-108468341 CTGTATACGTATAAGAAAAAAGG - Intronic
960218581 3:115074879-115074901 GTGTAAAAGAAAAAATAAAAAGG - Intronic
960579647 3:119265592-119265614 TTTTATCAGAAAAAGGAAATTGG - Intergenic
960699041 3:120423152-120423174 CTGTAAAATAATAAAGAAAATGG - Intronic
961782406 3:129328144-129328166 CTGTCTAAAAAAAAAAAAAAGGG + Intergenic
962096626 3:132299169-132299191 ATGTGTCAGAAAAAGAAAAATGG - Intergenic
962288819 3:134112354-134112376 TTAGATAAGAAAAAGAAAAATGG + Intronic
963172270 3:142262903-142262925 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
963386484 3:144601179-144601201 ATGTATAAGACAAAAGAGAATGG - Intergenic
963402611 3:144820074-144820096 GTCTCAAAGAAAAAGGAAAAAGG - Intergenic
963730646 3:148967968-148967990 CTGTCTTAAAAAAAGAAAAAAGG - Intergenic
963844984 3:150146269-150146291 CGTTAAAAAAAAAAGGAAAATGG + Intergenic
963950885 3:151199440-151199462 CTGTAAAAGAAACAAGGAAAGGG + Intronic
964260686 3:154832842-154832864 CTGGATAGGAAAAAGGGCAAAGG - Intergenic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965248510 3:166309064-166309086 GAGTAAAAGCAAAAGGAAAATGG + Intergenic
965267422 3:166561526-166561548 CTTTAAATCAAAAAGGAAAATGG - Intergenic
965373696 3:167895583-167895605 CTGTAGAAAAAGAAGCAAAATGG - Intergenic
965566643 3:170126544-170126566 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
966200115 3:177353368-177353390 GTGTTTAAGAAACAGCAAAAAGG + Intergenic
966295480 3:178416037-178416059 AAATAAAAGAAAAAGGAAAATGG + Intergenic
966333219 3:178839362-178839384 CTAGATAAGAAAGAGGAGAAAGG + Intronic
966498860 3:180613851-180613873 TTGTTTTAGAAATAGGAAAAAGG - Intronic
966575738 3:181500718-181500740 CTCAAAAAGAAAAAGGAAAAAGG - Intergenic
967200613 3:187069443-187069465 CTGCATAAGAACAGAGAAAAAGG - Intronic
967548417 3:190760317-190760339 TGTTATTAGAAAAAGGAAAAGGG - Intergenic
967574081 3:191069786-191069808 CTGAAGAAGAAAAAGAAGAATGG + Intergenic
967663318 3:192140039-192140061 CTTTATAATAAAAAAGAAACAGG - Intronic
967677539 3:192317494-192317516 CTGCTTAAGGAAAGGGAAAAAGG + Intronic
968257302 3:197287612-197287634 ACCTCTAAGAAAAAGGAAAAAGG + Intronic
968407407 4:352720-352742 ATGTATAGGACAAAGGAAAGTGG - Intronic
969007871 4:4036294-4036316 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969444696 4:7237907-7237929 ATTTAGAAGCAAAAGGAAAACGG - Intronic
969522111 4:7684430-7684452 CTGGATGAGGAAAAGGGAAAGGG - Intronic
970211841 4:13717984-13718006 CTGTATATGAGAAAGGGACAAGG - Intergenic
970302289 4:14693923-14693945 CTGAATAAGCAAAATGCAAATGG + Intergenic
970639451 4:18048161-18048183 CTGAATGAGAAAAATGTAAAGGG + Intergenic
970669570 4:18380529-18380551 CAGTCTAGGAAAAAGGAACAGGG + Intergenic
970947396 4:21711171-21711193 TGCTATAAGAAAAAGGAAATGGG + Intronic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971097944 4:23429270-23429292 CTAAATAGGAAAAAGGAAATTGG - Intergenic
971379731 4:26085703-26085725 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
971423432 4:26493916-26493938 CAGAATAGGAAAAAGGGAAAGGG - Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971817620 4:31509099-31509121 ATGTATTCCAAAAAGGAAAAGGG - Intergenic
971860568 4:32097824-32097846 ATGTGTAAGCAAAAGGAAATAGG - Intergenic
971986024 4:33825541-33825563 CTATATACTAAAAAGAAAAATGG - Intergenic
972086322 4:35221329-35221351 TTGTATTAAAAACAGGAAAAGGG + Intergenic
972451405 4:39203088-39203110 AAGAAAAAGAAAAAGGAAAAAGG - Intronic
972577932 4:40369006-40369028 CTGGATAAGGAAATGTAAAAAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972693533 4:41422599-41422621 CTATATCTGAAGAAGGAAAAAGG - Intronic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
973937769 4:55866668-55866690 GTGAATAAGAAAAATGAACACGG + Intronic
974126151 4:57698024-57698046 CTGTCTCAAAAAAAAGAAAATGG + Intergenic
974448600 4:62019748-62019770 CTTTACAAGAAAAATGACAATGG + Intronic
974484517 4:62489852-62489874 TTGAATACGAAAAAGAAAAAGGG - Intergenic
974689394 4:65276182-65276204 CATTACAAGAAAAAGGAAAAAGG + Intergenic
975126782 4:70791789-70791811 CTATATAACAAAAGTGAAAAGGG - Intronic
975164054 4:71157200-71157222 CTATCAAAGAAAAAGGAAATTGG + Intergenic
975281635 4:72568843-72568865 CTTTAAGAAAAAAAGGAAAAGGG + Intergenic
976232816 4:82863162-82863184 GAGAATAAGAAAAAGAAAAAGGG + Intronic
976958149 4:90930606-90930628 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
977556442 4:98491680-98491702 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
977745602 4:100543046-100543068 CGCTTTAAGAAAAAGAAAAAAGG - Intronic
977750541 4:100604848-100604870 CTGTATCCCAAATAGGAAAAAGG - Intronic
978737756 4:112103475-112103497 CTGTAAAAGGAAAAAAAAAAAGG - Intergenic
979588276 4:122446490-122446512 GATTAAAAGAAAAAGGAAAAGGG - Intergenic
979605394 4:122633064-122633086 CTGTCCAAGATAGAGGAAAAAGG - Intergenic
979683177 4:123483626-123483648 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
979791042 4:124781348-124781370 CTTTATAAGAAAAATGACACAGG - Intergenic
980066017 4:128189261-128189283 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
980121569 4:128733302-128733324 TGATATAAGAAATAGGAAAATGG - Intergenic
980181825 4:129410638-129410660 CTTTATAAGGCAAAGGAAGAAGG - Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980447459 4:132929157-132929179 CTGTATAAGAAAAGGAAATTAGG - Intergenic
980608262 4:135122155-135122177 CTCTATAAGAAAAGGGATCATGG - Intergenic
980912076 4:139003059-139003081 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
981007525 4:139890968-139890990 CTGGAAAAGAAACAGGAAAGAGG + Intronic
981189424 4:141843471-141843493 CTGTGTAAGAATAAACAAAAAGG + Intergenic
981499274 4:145431448-145431470 CTTTATAAGAGAAAGGCAAGAGG + Intergenic
981617712 4:146658905-146658927 CTGTCTAAGAAACAGGTAAGTGG + Intergenic
981849238 4:149209037-149209059 CTTTACAAGAAAGAGAAAAATGG - Intergenic
982362939 4:154542280-154542302 CTGTATAAAACAAAGTAGAATGG + Intronic
982624045 4:157742619-157742641 CTGAAAATGAAAAATGAAAATGG + Intergenic
982842853 4:160214057-160214079 ATGTCTATGAAAAAGGAAAGTGG - Intergenic
983190756 4:164751100-164751122 CTGCATCAAAAAGAGGAAAAGGG - Intergenic
983211819 4:164966246-164966268 CTGTTATAGAAAAAGCAAAAAGG + Intronic
983472791 4:168176993-168177015 CTGTCTCAAAAAAAGAAAAATGG + Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983900260 4:173126269-173126291 CTGTATAAAAAAAAGGTAAAAGG + Intergenic
983963354 4:173780793-173780815 ATGTATAAGGAAAAGAAATATGG + Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984056441 4:174935544-174935566 CTGTATCAGAAAGCAGAAAAAGG - Intronic
984163792 4:176284709-176284731 TTGCAGAAGAAAAAGAAAAATGG - Intergenic
984175182 4:176408768-176408790 CTGGATAAGTGACAGGAAAATGG + Intergenic
984451540 4:179910086-179910108 CTGTAAAAGGAAAAAAAAAAAGG + Intergenic
984538852 4:181011944-181011966 CAGAATGAGAGAAAGGAAAAAGG - Intergenic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985084888 4:186302768-186302790 TTATAAAAGAAAAAGAAAAAGGG - Intergenic
985436327 4:189932785-189932807 CTTAATAAAAAAAAAGAAAATGG + Intergenic
986100960 5:4610808-4610830 CATTATAAATAAAAGGAAAAGGG + Intergenic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
988393321 5:30664194-30664216 CTTTGTGATAAAAAGGAAAAAGG + Intergenic
988815088 5:34826766-34826788 CTGTTGCAGAAAAAGGAGAAGGG - Intronic
988832218 5:34999033-34999055 ATGTATGACAAAAAGGAAAAGGG - Intronic
988853545 5:35202993-35203015 CTGTCTAAGAACAAGGCCAATGG - Intronic
988884955 5:35546634-35546656 ATTTAAAAGGAAAAGGAAAAAGG - Intergenic
989814818 5:45722992-45723014 CTGAAAGAGAAAAAAGAAAAGGG + Intergenic
989829572 5:45898306-45898328 CTGTCTAAGAAAAGAAAAAAAGG + Intergenic
990302518 5:54462895-54462917 CTGGATATGAGGAAGGAAAATGG + Intergenic
990826283 5:59902645-59902667 TTGTATAAGAAAAACCATAAGGG + Intronic
990854299 5:60246116-60246138 CTATATAAGAAAATGAAAAAAGG - Intronic
990863826 5:60358342-60358364 CTGAAGAAGTAAAAGGCAAAAGG - Intronic
991037703 5:62144619-62144641 CTACAAAAGAAAAAGGAAATAGG + Intergenic
991132469 5:63138625-63138647 ATATATAACAAAAAGAAAAATGG - Intergenic
991133121 5:63149333-63149355 CTGTACAAAATAAAGGCAAAGGG - Intergenic
991247432 5:64522997-64523019 CTGGAAAAGAAAAGAGAAAATGG + Intronic
991261330 5:64671572-64671594 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
991403189 5:66275581-66275603 CTAAATAAAATAAAGGAAAATGG - Intergenic
991708212 5:69380770-69380792 CTGTCTCAGAAAAAAAAAAAAGG - Intronic
991861114 5:71014102-71014124 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
992435567 5:76752546-76752568 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
992570478 5:78050232-78050254 GTGTCTATAAAAAAGGAAAAAGG - Intronic
992764579 5:79985462-79985484 CTCTATAAAAAAAACTAAAAGGG + Intronic
993062025 5:83050078-83050100 AGGTATATGAGAAAGGAAAAGGG + Intergenic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993476747 5:88375795-88375817 CAGCATAAGAATAAGGCAAAGGG - Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993666285 5:90700808-90700830 CTCTATAACAAAAAAGAAAACGG - Intronic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994180692 5:96762714-96762736 ATGTATAAGAAAAAATATAAAGG - Exonic
995662618 5:114501680-114501702 CTGTAGAGGAAAAATCAAAATGG + Intergenic
995702008 5:114946837-114946859 CAGTAGAGGAGAAAGGAAAATGG + Intergenic
995802547 5:116013992-116014014 CTCTATAAAAGAAAGGGAAAGGG - Intronic
996051612 5:118941159-118941181 ATATATAATAAAAAGAAAAAAGG - Intronic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
996129548 5:119765124-119765146 ATGTAGGAGAAAAAGCAAAAGGG - Intergenic
996158995 5:120139090-120139112 TTGTAAAAAAAAAAAGAAAATGG - Intergenic
996318353 5:122186934-122186956 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
996622673 5:125527816-125527838 CGGAAAAAGAAAAAGTAAAATGG - Intergenic
997566275 5:134889227-134889249 CTGTGTCAAAAAAAGAAAAAGGG - Intronic
997807714 5:136935721-136935743 CCGCATAAGAAATAGGAACATGG - Intergenic
997811242 5:136972795-136972817 CTGTCTAAAAAAAAAAAAAAGGG - Intergenic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
998616526 5:143746524-143746546 TTGAATAAGAGAAAGGAATAGGG - Intergenic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999811527 5:155131838-155131860 CTTTAAAAAAATAAGGAAAATGG + Intergenic
999985148 5:156996470-156996492 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1000250732 5:159492179-159492201 CTGTCTATGAACAAGGGAAATGG + Intergenic
1000361973 5:160456184-160456206 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1000504480 5:162097930-162097952 CTCTAAAAGAAAAAAAAAAAAGG + Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000731282 5:164836780-164836802 CAATAAAAGAAAAAGGTAAAAGG - Intergenic
1001286593 5:170428163-170428185 CTACATAAGAAAAAAGAATAAGG + Intronic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001629049 5:173160952-173160974 CAGTATAAGACAACAGAAAAAGG + Intronic
1002079668 5:176729854-176729876 CTGTTTAAGAAAAGGGCAAAAGG + Intergenic
1003093251 6:3121991-3122013 ATGTAGAAGAAAAAGGAGATGGG + Intronic
1003210633 6:4062206-4062228 CGGAAAGAGAAAAAGGAAAACGG + Intronic
1003281513 6:4696359-4696381 TAGTATAAAAAAAAGTAAAAAGG + Intergenic
1003289274 6:4765566-4765588 CTGTATCAAAAAAAAAAAAACGG - Intronic
1003719011 6:8679200-8679222 CCGTCTCAGAAAAAAGAAAAAGG + Intergenic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1004412976 6:15399017-15399039 CAGTAGAAGGAAGAGGAAAAAGG + Intronic
1004632358 6:17434117-17434139 CTGTCCAGGAAAAAGAAAAAGGG - Intronic
1004682456 6:17909528-17909550 CTGTCTCAGAAAAAAAAAAAAGG + Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004739961 6:18450005-18450027 TTGGATAAGAAAAGGGAAATTGG - Intronic
1004888178 6:20071652-20071674 CTGTAAAACAAAAAACAAAACGG + Intergenic
1004960328 6:20781162-20781184 CTGGGTCAGAAAAAGGATAATGG + Exonic
1004987898 6:21103429-21103451 GAGTATAAGAAAAAAAAAAAAGG + Intronic
1005055164 6:21722270-21722292 GTGAATCAGAAAAAAGAAAAGGG - Intergenic
1005088191 6:22028333-22028355 CTCTACAAGAGCAAGGAAAAGGG - Intergenic
1005489126 6:26330526-26330548 GTTAATAAGAAATAGGAAAAAGG + Intergenic
1005974057 6:30783809-30783831 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1006927879 6:37668244-37668266 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007061020 6:38941112-38941134 CTGTCTCAGAAAAAAAAAAAAGG + Intronic
1007567878 6:42866783-42866805 AGGTATACGAGAAAGGAAAACGG - Exonic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1008140845 6:47830400-47830422 CTCTATAAGCAAAATGAAAGAGG - Intronic
1008234785 6:49031311-49031333 CTGTGTAAAAAAAAAAAAAATGG + Intergenic
1008239334 6:49089811-49089833 CCATATAAGAGAAAGGCAAAAGG + Intergenic
1008361847 6:50629029-50629051 CTGTTTAAAAAAAAAGATAAAGG + Intergenic
1008413253 6:51207948-51207970 GTGCATAATAAAAAGGAAGACGG - Intergenic
1008420632 6:51295108-51295130 CTGTTTAAGAGATAGGCAAATGG + Intergenic
1008604144 6:53123793-53123815 CTGTCCAAAAAAAAGAAAAAAGG - Intergenic
1009021686 6:57953605-57953627 CTGTCTAAAAAAAAAAAAAATGG - Intergenic
1009406053 6:63314053-63314075 CTCTATCAGAGGAAGGAAAAGGG + Intronic
1009629831 6:66181685-66181707 GTGTATAAGAAACAGCAAGATGG + Intergenic
1010223831 6:73470542-73470564 ATCTATAATAAAAATGAAAATGG - Intronic
1010307908 6:74346271-74346293 CTTTCTAAGAAAGAGGAAGAAGG + Intergenic
1010355528 6:74928227-74928249 CTGTAAAAGAATAAGAAAAATGG - Intergenic
1010369790 6:75094554-75094576 CTGCATAAGAGAAAGTTAAATGG + Intronic
1010393675 6:75365703-75365725 CTGTATAAACAAAAAAAAAAAGG - Intronic
1010445933 6:75948719-75948741 TTCTATGAGAAATAGGAAAATGG - Intronic
1010762538 6:79740066-79740088 CTAAAAAAGAAAAAGAAAAAAGG + Intergenic
1011029544 6:82907057-82907079 CTGTATGGGTAAAAGAAAAATGG + Intronic
1011050923 6:83149011-83149033 CTGTTTAAGAAAAAAAAAAGTGG + Intronic
1011292540 6:85791756-85791778 CTGTCTAAAAAAAAAAAAAAGGG - Intergenic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1011912178 6:92454205-92454227 ATCTATAGGAAAAAAGAAAAAGG + Intergenic
1012070974 6:94615774-94615796 CTAATTAAGAAAAATGAAAAAGG + Intergenic
1012288537 6:97422730-97422752 CTCTATAAGAACAAAGGAAAAGG - Intergenic
1013548949 6:111188314-111188336 ATAGTTAAGAAAAAGGAAAAAGG - Intronic
1013565493 6:111356136-111356158 CTATATAAGCAAAACAAAAAAGG + Intronic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1013712065 6:112913087-112913109 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
1013879916 6:114885000-114885022 CTTTATAAAAAATTGGAAAATGG - Intergenic
1013904681 6:115200738-115200760 ATTTATAAGAACAGGGAAAAGGG + Intergenic
1014635849 6:123845511-123845533 CTGTATAATAAAAATCAGAAAGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014757160 6:125314171-125314193 CTGTTTAATAAAAAGGTAATTGG + Intergenic
1015006263 6:128285508-128285530 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015230124 6:130905421-130905443 CTGTCTCAGAAAAAAAAAAAAGG - Intronic
1015535065 6:134259104-134259126 CTATCTAAGATAAAGGAAAAGGG + Intronic
1015882483 6:137882858-137882880 CTCTAGAAGAAAAAAAAAAAAGG + Exonic
1015917937 6:138236998-138237020 CTGTATTTGAAAAAAAAAAAAGG - Intronic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016241481 6:141936475-141936497 ATGTATAAGGTAAATGAAAACGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016835109 6:148469382-148469404 CTGTTTCAGAAACATGAAAATGG + Intronic
1017153821 6:151305064-151305086 CTGTGTAAGAAAAGGATAAACGG - Intronic
1017306553 6:152924770-152924792 TTCAACAAGAAAAAGGAAAAGGG + Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017921654 6:158878311-158878333 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1018315366 6:162551532-162551554 ATCCAAAAGAAAAAGGAAAAGGG - Intronic
1018394158 6:163364512-163364534 CTTTTTTAGCAAAAGGAAAATGG + Intergenic
1019338562 7:496495-496517 CTTTATACAAAAAAGAAAAATGG + Intergenic
1019989096 7:4680116-4680138 CTCTATAAAAAAATTGAAAAAGG + Intergenic
1020053946 7:5103891-5103913 ATGTATAAGAATGGGGAAAATGG + Intergenic
1020179612 7:5911744-5911766 CTCTAAAAGAAAAAGACAAATGG + Intronic
1020303325 7:6813132-6813154 CTCTAAAAGAAAAAGACAAATGG - Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021075158 7:16294462-16294484 CTGTAAAAAAAAAAGTAAATTGG - Intronic
1021162509 7:17293416-17293438 ATGCATAAGAACAAGCAAAAAGG + Intergenic
1021199847 7:17716386-17716408 CTTTTTAAGGAAAAAGAAAAAGG - Intergenic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021716495 7:23467674-23467696 CTTCATAAGAAAAAGAAAAAGGG + Intronic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022499899 7:30876275-30876297 CTGTATAAGAAAAGACACAAAGG - Intronic
1022687402 7:32609521-32609543 CTGAATAAAATAAAGGAAATGGG + Intergenic
1023097233 7:36673530-36673552 CTGTCTCAGGAAAAGAAAAAAGG + Intronic
1023148237 7:37174197-37174219 CTTTATAGGAAAAAGGAAGTGGG - Intronic
1023231713 7:38038870-38038892 CTTTATAAGCAAAGTGAAAATGG - Intergenic
1023311408 7:38890684-38890706 CTCTAAAAGAAAAAAAAAAAGGG - Intronic
1023800999 7:43834750-43834772 CAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024198706 7:47085295-47085317 CAGTATAGGCCAAAGGAAAAAGG - Intergenic
1024362137 7:48479240-48479262 CTGTCTCAAAAAAAGGAAAAAGG - Intronic
1024379411 7:48678052-48678074 CTGTATATTAGAAAAGAAAAAGG - Intergenic
1024489568 7:49963885-49963907 CAGCATAATAAAAATGAAAAAGG + Intronic
1024958254 7:54949106-54949128 CTGAAAAAAAAAAAAGAAAATGG + Intergenic
1025008809 7:55378706-55378728 TTTTATGAGAAATAGGAAAAGGG + Intronic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1025272342 7:57535705-57535727 CTATATACTAAAAAGAAAAATGG - Intergenic
1025601259 7:62999746-62999768 GTGTAGAAGAAAAAGTAAAGGGG - Intergenic
1025837328 7:65106472-65106494 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1025958338 7:66199716-66199738 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1026367419 7:69662547-69662569 CTGCCTTAGAAAGAGGAAAATGG + Intronic
1026497371 7:70914652-70914674 ATAAATAAGAAAAAGGTAAATGG - Intergenic
1026564859 7:71481443-71481465 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1026929578 7:74216373-74216395 CTGTCCAAAAAAAAGAAAAAAGG - Intronic
1026939263 7:74277505-74277527 CTGTCTTAAAAAAAGAAAAAAGG - Intergenic
1027237142 7:76304776-76304798 CTTTAAAAGAAAAAAAAAAAAGG + Intergenic
1027357509 7:77372654-77372676 TTGTATAAGTAAAAGGTAAACGG + Intronic
1027477947 7:78656984-78657006 CAGTATAAAAAAAAAAAAAAAGG + Intronic
1027512546 7:79101420-79101442 TGGTTTTAGAAAAAGGAAAATGG + Intronic
1027694302 7:81389522-81389544 ATTTATAATAAAAAGCAAAAAGG + Intergenic
1027809944 7:82883688-82883710 CTGGATAAGAAAAAGCTAATAGG - Intronic
1028075484 7:86508588-86508610 CAGAATATGACAAAGGAAAAGGG + Intergenic
1028123050 7:87078640-87078662 CTGTATCAAAAAAAAAAAAAAGG + Intergenic
1028460924 7:91091662-91091684 CTGTCAAAGAAAAAGAGAAAGGG + Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1028962574 7:96765912-96765934 TTGTATAAACAAAAGAAAAAAGG - Intergenic
1029133579 7:98352161-98352183 CTGTATCAATAAAAGAAAAATGG + Intronic
1030274407 7:107704475-107704497 CTTTAAAAGAAAAAAAAAAAAGG - Intronic
1031064051 7:117085077-117085099 CTGTACAAGAAAAAGAATAAAGG + Intronic
1031346807 7:120676834-120676856 CTGGATAGGAAAAAGAAAAAAGG + Intronic
1031473731 7:122197923-122197945 TTGGGTAAGAAAAAGGAAATGGG - Intergenic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1031616242 7:123884513-123884535 CACTATAAGACAATGGAAAAAGG + Intergenic
1031657505 7:124376192-124376214 TTAAATAAGAAAAAGAAAAAAGG + Intergenic
1031713925 7:125083336-125083358 CTCCATAAAAAATAGGAAAAAGG - Intergenic
1031842303 7:126758896-126758918 CTCAAAAAGAAAAAGAAAAAAGG - Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032057640 7:128696658-128696680 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1032081635 7:128861664-128861686 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1032120687 7:129153548-129153570 CTGGATAAGAAACAAAAAAAAGG + Intronic
1032282983 7:130520320-130520342 ATAAAAAAGAAAAAGGAAAAGGG + Intronic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1032719654 7:134540211-134540233 CTGTCTCAGAAAAAAAAAAAAGG + Intronic
1032986059 7:137338514-137338536 TTTTATGAGAAAAAGGAAAGTGG - Intronic
1033071904 7:138210549-138210571 CAGTATAAGAAAACAGAAAATGG + Intergenic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033495961 7:141896524-141896546 CCATATAAGTAAAAGGAAAAGGG - Intergenic
1033574692 7:142669442-142669464 ATGTTAAAGAAACAGGAAAACGG - Intergenic
1033656060 7:143375439-143375461 CTGTCTCAGAAAAAGGGAACAGG - Intergenic
1033720407 7:144052983-144053005 CTTTAAAAGAAAAGGGAAAGAGG + Intergenic
1033765404 7:144484311-144484333 CTATTTAAAAAAAAGGAAAATGG + Intronic
1033828945 7:145228554-145228576 CTGCATAAAGAAAAGAAAAAAGG - Intergenic
1033898764 7:146110083-146110105 CAGTGGAATAAAAAGGAAAATGG - Intergenic
1033991390 7:147291495-147291517 CTAAATAATAAAAAAGAAAAAGG - Intronic
1034378357 7:150666396-150666418 CTGGGTAAGAAAAAGTAAATGGG - Intergenic
1034589385 7:152127160-152127182 GTGAATAAGAATAAAGAAAAAGG + Intergenic
1034652987 7:152706938-152706960 CTGTAAAAGAAAAATGCAAAGGG - Intergenic
1035006459 7:155665486-155665508 CTGTACAAAAACAAAGAAAAAGG - Intronic
1036112469 8:5918948-5918970 CTGAAAAATAAAAAAGAAAAAGG - Intergenic
1036615532 8:10384705-10384727 CTGTTAAAGAAAAAATAAAATGG + Intronic
1036661029 8:10708847-10708869 CTGGCTGAGGAAAAGGAAAACGG + Intronic
1036720971 8:11174932-11174954 CTGTCCTAGAAAGAGGAAAAGGG - Intronic
1036811383 8:11869242-11869264 CTGTATTAAAAAAAAAAAAAAGG + Intronic
1037010670 8:13838656-13838678 CTGCCTAAGAAAAAAAAAAAAGG - Intergenic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037608186 8:20455086-20455108 CTCTATAAAAAATAGAAAAAAGG - Intergenic
1037712815 8:21369123-21369145 CTATATTACAAACAGGAAAAAGG + Intergenic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038350803 8:26774662-26774684 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
1038442608 8:27582514-27582536 CAGTAGAGGAGAAAGGAAAAGGG - Intergenic
1038501720 8:28050379-28050401 CTGTTAAAAAAAAAGAAAAAAGG + Intronic
1038629901 8:29231759-29231781 CTCTAAAAAAAAAAGGAAAAAGG + Intronic
1038645558 8:29358792-29358814 TTGTCTAAGAGAAAGGAATAAGG - Intergenic
1038703816 8:29875695-29875717 CTGAATAATAAAAAAGAAAATGG + Intergenic
1038896320 8:31786694-31786716 CTGTATAATAAACTGGTAAATGG - Intronic
1039099347 8:33924202-33924224 CTTTATAAGAAGGAGGAAATTGG - Intergenic
1039229123 8:35423567-35423589 CGGTGTAATAAACAGGAAAATGG + Intronic
1039307332 8:36277081-36277103 CTGTATCAAAAAAAAAAAAATGG - Intergenic
1039357948 8:36841974-36841996 CTGTTAAAAAAAAAAGAAAAGGG + Intronic
1039361916 8:36885786-36885808 CTGTCTAAAAAAAAAGAAAAAGG + Intronic
1039373572 8:37011301-37011323 CTTTCTTAGAGAAAGGAAAATGG - Intergenic
1039507938 8:38065625-38065647 CTGTTTAAGAAAAAAGAAAAAGG + Intergenic
1039863144 8:41476954-41476976 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1040044621 8:42949909-42949931 CTGTCTAAAAAAAAAAAAAAAGG + Intronic
1040108742 8:43556095-43556117 GGGTATGAGATAAAGGAAAATGG - Intergenic
1040423891 8:47265006-47265028 TTGAACAAGAAATAGGAAAAAGG + Intronic
1040458988 8:47628768-47628790 CTGTCTAACAAAATGGAAATGGG + Intronic
1040689466 8:49917729-49917751 TTGAATAAGAAAACAGAAAAGGG - Intronic
1040980314 8:53240270-53240292 CAATATAATAAAAAAGAAAAAGG + Intronic
1041319850 8:56601872-56601894 CTGTCTCACAAAAAGAAAAAAGG + Intergenic
1041532862 8:58891311-58891333 CTAAATAGGAAAAAGAAAAAAGG + Intronic
1041567742 8:59299625-59299647 CTGAATAATAAAAAGTAGAATGG + Intergenic
1041654137 8:60331582-60331604 CTTTTTAATAAAAAGAAAAATGG + Intergenic
1041724426 8:61004825-61004847 CTTTTTAAGAAAAATGAAAGGGG - Intergenic
1041749185 8:61240304-61240326 CTGTTGAAGAAACAGGAAAATGG - Intronic
1041842459 8:62288097-62288119 CTGTAGAAGCACAAGGCAAATGG - Intronic
1041876010 8:62687928-62687950 CTTTAAAAGGAAAAGAAAAAGGG + Intronic
1041989221 8:63965718-63965740 GTGTAAAAGAATAACGAAAATGG + Intergenic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042637898 8:70898911-70898933 CTCAAAAAGAAAAAGAAAAATGG - Intergenic
1042680861 8:71381445-71381467 CGGTGGAAGAAAAAGGAAAGAGG + Intergenic
1042688650 8:71470932-71470954 CTTTAAAAAAAAAAGGAAAAAGG + Intronic
1042807107 8:72782849-72782871 CAGAAAAAGAAAAAGAAAAAAGG - Intronic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1042816684 8:72885718-72885740 GTCTAAATGAAAAAGGAAAAAGG - Intronic
1042873055 8:73415380-73415402 CTGGAGAAGAATGAGGAAAAAGG - Intergenic
1043040558 8:75257367-75257389 CAGTCTAAGAAATAAGAAAATGG - Intergenic
1043078730 8:75736703-75736725 CTGTTTGAGCAAAAGGCAAATGG + Intergenic
1043261749 8:78209154-78209176 CTGTTTAAGCAAATGCAAAATGG + Intergenic
1043265474 8:78262248-78262270 CTGTTTAGGAGAGAGGAAAAGGG - Intergenic
1043357809 8:79434267-79434289 ATTAAGAAGAAAAAGGAAAAAGG - Intergenic
1043722848 8:83568598-83568620 ATGTATAAACAAAAGGGAAATGG + Intergenic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1044330786 8:90917801-90917823 CAGTAAAAGAAAAAGTAGAATGG - Intronic
1044527496 8:93267974-93267996 CTGTTTAAGAAATAGAAAAGAGG - Intergenic
1044668958 8:94659190-94659212 TTGTTTAAAAAAAAAGAAAATGG + Intronic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044868592 8:96596644-96596666 CTGTATAACAAAAATGTAAGAGG + Intronic
1045169447 8:99647570-99647592 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1045524433 8:102929834-102929856 CTGAAAGAGTAAAAGGAAAAAGG + Intronic
1045535469 8:103023046-103023068 CTGTCTCTGAAAAACGAAAAAGG + Intronic
1045887678 8:107118937-107118959 CTGTATGGGAAAATGGAAATGGG - Intergenic
1046281982 8:112045277-112045299 CTTTAAAAGAAAAAAAAAAAAGG + Intergenic
1046299141 8:112263134-112263156 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1046567908 8:115923735-115923757 CTGGACAAGAATGAGGAAAAGGG + Intergenic
1046773069 8:118136031-118136053 CTGTCTAAAAAAAAAGAAAAAGG - Intergenic
1046827521 8:118707457-118707479 CTATATAAGAACAAAGAACAAGG + Intergenic
1047177056 8:122551821-122551843 CAACATAAGAAAAAGGATAATGG + Intergenic
1047236301 8:123044980-123045002 AGGTATCAGAAATAGGAAAATGG - Intronic
1047271048 8:123359097-123359119 TTGTATAATGAAAAGGGAAAAGG + Intronic
1047316339 8:123737331-123737353 CCATCTCAGAAAAAGGAAAATGG - Exonic
1047589267 8:126309859-126309881 CTTGAGAAGAAAAGGGAAAATGG - Intergenic
1047848856 8:128834323-128834345 CTGAATAAGAAAAGGGGTAAAGG + Intergenic
1048017949 8:130514176-130514198 CTGTTTAAAAAAAATAAAAAAGG + Intergenic
1048189548 8:132275580-132275602 CTGTCTAAAAAAAAAAAAAAAGG - Intronic
1048712232 8:137225063-137225085 GTGTAAAAGCAAAGGGAAAATGG - Intergenic
1049037100 8:140085333-140085355 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1049086031 8:140479280-140479302 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1049127016 8:140800066-140800088 ATATATAAGAAAAAGTAGAAAGG + Intronic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050187225 9:2987262-2987284 GTATATAAGAAAAGGAAAAAAGG + Intergenic
1050243582 9:3663131-3663153 CTCTATGACTAAAAGGAAAAGGG + Intergenic
1050276313 9:4004557-4004579 ATCTACAAGAAAAAAGAAAAGGG + Intronic
1050322147 9:4463775-4463797 TTATATAAGAAACAGAAAAATGG - Intergenic
1050425564 9:5509288-5509310 CCCTATAAGCACAAGGAAAAGGG + Intergenic
1050530433 9:6583669-6583691 CTGTCTGAAAAAAAGAAAAAAGG + Intronic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1050712403 9:8480485-8480507 CTGTATGAGAACAATGAGAAAGG + Intronic
1050738320 9:8790019-8790041 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1050753633 9:8972482-8972504 GTGTAGAAGAAAAAGAAGAAAGG + Intronic
1050828336 9:9978354-9978376 ATCTATAAGAAAAATTAAAATGG + Intronic
1050997347 9:12237007-12237029 GTGTAAAAGAAAAAGCTAAAGGG + Intergenic
1051134448 9:13902600-13902622 AGGAAAAAGAAAAAGGAAAAAGG + Intergenic
1051342393 9:16123608-16123630 GTGATTAAGAAAAAGGAAAAAGG - Intergenic
1051401703 9:16690759-16690781 CAGCATAAGATAAAAGAAAATGG + Intronic
1051720623 9:20033472-20033494 CTGTCTACTAAAAAGTAAAAGGG - Intergenic
1051820775 9:21164485-21164507 CTCTAGATGAAAAAAGAAAATGG + Intergenic
1052005075 9:23337497-23337519 CTGTTTAAAAAATTGGAAAAGGG + Intergenic
1052032393 9:23643608-23643630 GAGTCTAAGAGAAAGGAAAAAGG - Intergenic
1052278785 9:26708752-26708774 CTGTCTAAGTCAAAAGAAAATGG + Intergenic
1052553158 9:29978356-29978378 GTGAATAAGAAAACTGAAAATGG + Intergenic
1052668287 9:31522198-31522220 CTTTCTAAGAAAATGAAAAATGG - Intergenic
1052730814 9:32283237-32283259 ATTTGTAAGAAAAAAGAAAAAGG + Intergenic
1052861078 9:33438281-33438303 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1052947008 9:34176687-34176709 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1053099981 9:35363625-35363647 CTTTAAAAGAGAAAAGAAAATGG + Intronic
1053100509 9:35367914-35367936 CTTTGTAGGAAAAAGGGAAAAGG - Intronic
1053526757 9:38837875-38837897 ATCTATAAGAAAAAAAAAAAAGG - Intergenic
1053710737 9:40805182-40805204 CTGTCTAAAAAAAAAAAAAAAGG - Intergenic
1053854307 9:42322282-42322304 TTGTATAAAAAAAAGAAAATTGG - Intergenic
1053867721 9:42457473-42457495 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1054186442 9:61955905-61955927 CGGTATAAAAAAAAAAAAAAAGG - Intergenic
1054569915 9:66799376-66799398 CTGTATAAAAAAAAGAAAATTGG + Intergenic
1055246189 9:74246496-74246518 CAGGACAAGAAAAAGGCAAAAGG - Intergenic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055271660 9:74567030-74567052 CTGTCTCAGAAAAAAAAAAAGGG - Intronic
1055600053 9:77907045-77907067 CTATTTGAGAAAAAGAAAAAAGG + Intronic
1055953412 9:81751864-81751886 CTTTATAAGAAAAATCAGAAAGG + Intergenic
1056266169 9:84898679-84898701 CTGTCTTAGAAAAAAAAAAATGG - Intronic
1056360911 9:85856609-85856631 ATGTAGAAAAAAAAGTAAAAGGG - Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1056880058 9:90382624-90382646 CTGTCTCAGAAAAAAAAAAAAGG + Intergenic
1056935272 9:90911408-90911430 CTGGATAAAAAAGAAGAAAAGGG - Intergenic
1056975745 9:91251593-91251615 CTGTAAAAGAAAAAGGGAAAGGG + Intronic
1057323340 9:94034735-94034757 CTGTATAAGAACAATTAATATGG + Intronic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1057939978 9:99273390-99273412 CTGTGAAATAGAAAGGAAAAAGG - Intergenic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058234546 9:102473414-102473436 CTATGGGAGAAAAAGGAAAAGGG + Intergenic
1058268560 9:102939118-102939140 TTACATAAAAAAAAGGAAAATGG - Intergenic
1058287959 9:103204122-103204144 ATGTAAAAAAAAAGGGAAAAAGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058782140 9:108348766-108348788 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1058867709 9:109176697-109176719 CTGGAGAAGAAACAGGAAAGAGG + Intronic
1059207717 9:112482441-112482463 CTCAAAAAAAAAAAGGAAAAAGG - Intronic
1059363385 9:113765871-113765893 GAGTAGAAGAGAAAGGAAAAGGG - Intergenic
1059648572 9:116292801-116292823 CTGTAGATAAAAAAGAAAAAGGG + Intronic
1060035127 9:120248768-120248790 CTGTCTTATAGAAAGGAAAATGG - Intergenic
1061228461 9:129296100-129296122 CAGTATAATAAAAAAAAAAAAGG - Intergenic
1061337503 9:129950796-129950818 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1061744395 9:132728903-132728925 CTCTAAAAGAAAAAAAAAAAAGG - Intronic
1061830253 9:133287672-133287694 CTGTCTCAGAAAAAAAAAAAAGG - Intergenic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1185481764 X:451574-451596 TTGTAAAAGATAAAGGAAAGGGG - Intergenic
1185532156 X:830576-830598 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1185571296 X:1136883-1136905 CTGTCTCAAAAAAAAGAAAAGGG - Intergenic
1185657023 X:1693697-1693719 CTCTAAGAGAAAAAGAAAAAGGG - Intergenic
1185741633 X:2538008-2538030 ATGAACAAGAACAAGGAAAAGGG - Intergenic
1185921725 X:4100511-4100533 CTGTATAGTAAAACAGAAAAGGG - Intergenic
1186154677 X:6712745-6712767 CTGCATAAGAAACACCAAAAGGG + Intergenic
1186322847 X:8449028-8449050 CTGTCTAAAAAAAAAAAAAAAGG + Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1186489198 X:9958330-9958352 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
1186840683 X:13482028-13482050 CTGGAAAGGAACAAGGAAAAAGG - Intergenic
1187303349 X:18073037-18073059 TTGTAGAGGAAAAAGGGAAAGGG + Intergenic
1187340375 X:18415853-18415875 TCATATAAAAAAAAGGAAAAAGG - Intergenic
1187708847 X:22033870-22033892 TTGTATGAGAAAAATTAAAACGG - Intronic
1187766496 X:22648346-22648368 CTGTAGAAGAATAAGTAAAGGGG - Intergenic
1187980527 X:24752071-24752093 CTTAAAAATAAAAAGGAAAAGGG - Intronic
1188090563 X:25959368-25959390 ATTTATAAAAATAAGGAAAAAGG - Intergenic
1188303056 X:28529107-28529129 TTGTATAAGAGAAGGGAAAGAGG - Intergenic
1188929684 X:36091821-36091843 TGGAAAAAGAAAAAGGAAAATGG - Intronic
1188946581 X:36312375-36312397 CTGTTGGAGAAAAAGGAACATGG + Intronic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189260941 X:39678452-39678474 CTTTAAAAGAAAAAAAAAAAAGG - Intergenic
1189283332 X:39834461-39834483 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1189284101 X:39839729-39839751 CTGTCTAAGAAAAAATAAAAAGG - Intergenic
1189501111 X:41560048-41560070 CTGTATGAGCAAAAGGCAATTGG - Intronic
1189507185 X:41623711-41623733 CTGTCTCAAAAAAAAGAAAAGGG - Intronic
1189638370 X:43037945-43037967 CTGTATAGGAGGAAGGACAATGG - Intergenic
1190244602 X:48683045-48683067 CTCTGTAATTAAAAGGAAAAGGG + Intronic
1190662649 X:52669056-52669078 CTGTAAGAGAAAAAAAAAAAAGG - Intronic
1190851040 X:54241973-54241995 GTATATAAGAAAAATAAAAATGG + Intronic
1191176673 X:57510253-57510275 CAGGAAAAGAAAAAGGAAAGAGG + Intergenic
1191640548 X:63426882-63426904 CTTTAGTATAAAAAGGAAAAAGG + Intergenic
1191722958 X:64249833-64249855 CAGAAGAAGAGAAAGGAAAAGGG - Intergenic
1192118048 X:68430131-68430153 GTGTTGAGGAAAAAGGAAAAAGG - Intronic
1192776225 X:74248350-74248372 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1192924580 X:75742030-75742052 GTGTATAAAGAAAGGGAAAAAGG - Intergenic
1193019269 X:76772877-76772899 CTGTAGAAGACAAAGATAAATGG + Intergenic
1193691169 X:84645067-84645089 GACTACAAGAAAAAGGAAAAAGG - Intergenic
1194196162 X:90895247-90895269 CTGTCTAACAACAAGAAAAATGG + Intergenic
1194247269 X:91531104-91531126 CTGAATAGGAAAAAAAAAAATGG - Intergenic
1194406462 X:93502293-93502315 ATTTATTAAAAAAAGGAAAAGGG + Intergenic
1195235358 X:102891497-102891519 CTATTTAAGAAAATGTAAAAAGG + Intergenic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195650638 X:107279882-107279904 CTGTAACAGAAAATGGTAAAGGG - Intergenic
1195777377 X:108422359-108422381 CTGTCTAAAAAGAAAGAAAAAGG + Intronic
1196356841 X:114804982-114805004 ATGTCAAAGAAAAAGGAAACCGG + Intronic
1196470901 X:116025323-116025345 CTGTTTAAGAAAAATAAAATTGG + Intergenic
1196541458 X:116913909-116913931 TTATATATTAAAAAGGAAAATGG - Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1196647353 X:118132200-118132222 AAGTATATGAAAAGGGAAAAAGG + Intergenic
1196715655 X:118808462-118808484 CTGTAGAAGACAGAGGAACAAGG - Intergenic
1196791139 X:119466133-119466155 CTGTACCAGAAAAAGGACATTGG - Intergenic
1196840699 X:119856447-119856469 CTAAAAAAGAAAAAGCAAAAAGG - Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197170198 X:123425177-123425199 TTGTATAAGAAAATCCAAAATGG - Intronic
1197195049 X:123691369-123691391 CTTTCAAAGAAATAGGAAAAAGG + Intronic
1197227822 X:123971750-123971772 CTGCCTAAGAAAATGGTAAAGGG - Intronic
1198059004 X:133024935-133024957 CTGTATTAGAACATGGAAAGAGG + Intronic
1198130768 X:133692762-133692784 CTGAATAAGAAAAATGGAAGTGG - Intronic
1198139848 X:133791781-133791803 AAGGAAAAGAAAAAGGAAAAAGG - Intronic
1198430238 X:136558197-136558219 CTGTCTCTGAAAAAGCAAAAAGG + Intergenic
1198600577 X:138280963-138280985 TTGTAAAAAAAAAATGAAAATGG - Intergenic
1198824457 X:140684722-140684744 ATATAAAAGAAAAAGAAAAAGGG + Intergenic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic
1199728485 X:150607554-150607576 ATGTATAGGGAAAAGGATAAAGG - Intronic
1200356641 X:155559346-155559368 ATATATAAGAAATAGGAAAAAGG - Intronic
1200411272 Y:2864381-2864403 ATTTAAAAAAAAAAGGAAAAAGG - Intronic
1200485079 Y:3759581-3759603 CTCAAAAAGAAAAAAGAAAAAGG + Intergenic
1200542006 Y:4469439-4469461 CTGTCTAACAACAAGAAAAATGG + Intergenic
1201416020 Y:13750430-13750452 GTGTATAAGAATAGGGGAAAGGG + Intergenic
1202142494 Y:21742981-21743003 CTGTCTAAACAAAAGAAAAATGG + Intergenic
1202144364 Y:21762637-21762659 CTGTCTAAACAAAAGAAAAATGG - Intergenic