ID: 1017422370

View in Genome Browser
Species Human (GRCh38)
Location 6:154285866-154285888
Sequence TTATGTTACCAAGTGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017422370_1017422371 16 Left 1017422370 6:154285866-154285888 CCTTGAATCACTTGGTAACATAA 0: 1
1: 0
2: 1
3: 19
4: 175
Right 1017422371 6:154285905-154285927 TCTTAGAACATAAGTTTCATAGG 0: 1
1: 0
2: 0
3: 19
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017422370 Original CRISPR TTATGTTACCAAGTGATTCA AGG (reversed) Intronic
905015567 1:34776170-34776192 TGATGTTACCAAGTGAGCAAGGG + Intronic
905486059 1:38297671-38297693 TTATGTTTCCCAGTGGTACAAGG - Intergenic
908466591 1:64402232-64402254 TTATGTTTCCAAGTGATACTTGG - Intergenic
909295121 1:73937886-73937908 CTATATTACCAAGGGATTTAGGG + Intergenic
910179379 1:84464416-84464438 TTGTGTAACCAAGTGATTGAAGG - Intergenic
912239365 1:107888761-107888783 TTTTGTTTCAAAGTGAGTCAGGG - Intronic
915836057 1:159175988-159176010 TTTTCCTACCAAGTGATTTAAGG - Intronic
916200482 1:162266457-162266479 TTTTCTTACCAGGCGATTCATGG - Intronic
916845527 1:168646144-168646166 TTATCTCACCAAAAGATTCATGG + Intergenic
916855372 1:168743837-168743859 TTAAGTTTTCAAGTCATTCAGGG - Intergenic
918910742 1:190565215-190565237 TTAATTTGCCAAGTGATACATGG - Intergenic
919214460 1:194534567-194534589 TTATGTTCCCAAGAGAATTATGG + Intergenic
921241073 1:213183531-213183553 TTATACTACTAAGTAATTCATGG + Intronic
921807042 1:219467109-219467131 TTAGGTAACCCAGTGGTTCAGGG + Intergenic
922916527 1:229262626-229262648 ATATGCTACCAAGTGATTGTGGG - Intergenic
923892455 1:238230862-238230884 TGATGTTACAAAATCATTCATGG + Intergenic
924777829 1:247122804-247122826 TTATGTTCTCATGTGTTTCACGG + Intronic
1063589218 10:7379309-7379331 ATATCTCACCAAGTGATTCCAGG + Intronic
1064668443 10:17682809-17682831 TTGTGTTATCAAGTCATTGAGGG + Intronic
1064952663 10:20871713-20871735 TTATGTTAACAAGTCATTTCAGG + Intronic
1065514198 10:26508541-26508563 TTATGGGGCAAAGTGATTCAAGG - Intronic
1065683404 10:28260400-28260422 TTATCTTGACAAGTGATTGAAGG - Intronic
1065817415 10:29494775-29494797 GTACGTTATCAAGTGAATCAGGG + Intronic
1066650989 10:37654875-37654897 TTATGTTCCCAAGGGAATTATGG - Intergenic
1068327550 10:55514205-55514227 TGATGTTACAAAGTCATTCAAGG + Intronic
1073777261 10:106800283-106800305 TTATTTTTCAAAATGATTCATGG - Intronic
1075562358 10:123477460-123477482 TTCTGTTACCAAGAGTTTAATGG - Intergenic
1076262849 10:129082882-129082904 TTATGTTACAAAATGATGCATGG - Intergenic
1078976312 11:16482313-16482335 TGATGTTACAAAGTCATGCATGG - Intronic
1079632451 11:22694609-22694631 ATATCATACCAAGTGATTCCTGG + Intronic
1081600135 11:44487196-44487218 TTATGCTAACAAGTGACTCACGG - Intergenic
1082221002 11:49636715-49636737 TTCTTTTTCCAAATGATTCATGG + Intergenic
1085765633 11:79279477-79279499 TTATGTAATGAATTGATTCAGGG + Intronic
1086628042 11:88982405-88982427 TTCTTTTTCCAAATGATTCATGG - Intronic
1086689103 11:89768594-89768616 TTACTTTTCCAAGTGACTCAGGG - Intergenic
1086699751 11:89887583-89887605 TTACTTTTCCAAGTGACTCAGGG + Intergenic
1086706420 11:89956933-89956955 TTACTTTTCCAAGTGACTCAGGG - Intergenic
1086716755 11:90071366-90071388 TTACTTTTCCAAGTGACTCAGGG + Intergenic
1090163582 11:124521586-124521608 ATATGTTACCAAGAGTTTCATGG + Intergenic
1091629635 12:2149969-2149991 TTATGATAACTAGTGATGCATGG + Intronic
1092151049 12:6248975-6248997 TCTTGTTTCCAAGAGATTCAGGG - Intergenic
1092267248 12:6991388-6991410 TGATGTTACAAAGTCATGCATGG - Intronic
1092749204 12:11702596-11702618 TTTTGTTACCAAGAGATTACAGG - Intronic
1093116314 12:15215948-15215970 TTATTTTAACAAATGATACAAGG + Intronic
1093604507 12:21073813-21073835 TTATGTTCCCAAGGGAATTATGG + Intronic
1094291241 12:28852515-28852537 TTATTTTACCATGGAATTCATGG - Intergenic
1095422017 12:42033972-42033994 TACTGTTACCAAATGATTCATGG + Intergenic
1096793104 12:54057414-54057436 TTATGTAATCAAGTGAATTAGGG + Intergenic
1097467328 12:59943654-59943676 TTTTGTTACCAAGTGATTGATGG + Intergenic
1098385798 12:69917173-69917195 AAATGAAACCAAGTGATTCAGGG - Intronic
1102620133 12:114188009-114188031 GTATGTTACCTACTAATTCAAGG - Intergenic
1110301130 13:73928352-73928374 TTATGTTTTCATGTGATACATGG + Intronic
1113068920 13:106399678-106399700 TTTTGTTCCCAAGTAAGTCAAGG + Intergenic
1115610411 14:35043964-35043986 TTATGTTACAAAGTGAAAGAAGG + Intergenic
1116507230 14:45699074-45699096 TTCTGTTCCCAAGTTCTTCATGG - Intergenic
1118420101 14:65593178-65593200 TTATGTTTTACAGTGATTCAAGG - Intronic
1123214158 14:106791097-106791119 TTATTTTACAAGGTGATTTATGG - Intergenic
1126020318 15:44394100-44394122 TTATCCTACAAAGTGATTTATGG - Intronic
1126342885 15:47662888-47662910 TTATTATTCCAAATGATTCATGG - Intronic
1131688336 15:94796441-94796463 TTATGTTTCCAAGTAAATTAAGG - Intergenic
1135872113 16:26160744-26160766 TGATGTTACCATCTGATTCTAGG - Intergenic
1136870449 16:33802798-33802820 CTATTTTACAAGGTGATTCATGG + Intergenic
1142227179 16:88883227-88883249 TGAGGTTACCCATTGATTCACGG - Intronic
1203101723 16_KI270728v1_random:1313252-1313274 CTATTTTACAAGGTGATTCATGG - Intergenic
1143310507 17:5984310-5984332 TGATGTTACAAAGTAATGCATGG + Intronic
1146894506 17:36531860-36531882 TTATTTTACCAAGTGTTGCCAGG - Intronic
1149144116 17:53469192-53469214 TTATGTTATCAGGTCATTGATGG - Intergenic
1150013390 17:61528152-61528174 TTATGTGACAAAATCATTCATGG - Intergenic
1151050195 17:70969603-70969625 TGATGTCATCAAGTGATTTATGG - Intergenic
1151133229 17:71920100-71920122 TCCTGTGACCAAATGATTCATGG + Intergenic
1155097820 18:22576492-22576514 TAATTTTACTAAGTGTTTCATGG + Intergenic
1155614099 18:27701514-27701536 TTATCTTCCCCACTGATTCAGGG - Intergenic
1156737633 18:40280303-40280325 TAATTTTATCAAGTTATTCAGGG - Intergenic
1158623899 18:59055628-59055650 TTCAGTTATCAAGTGATACAGGG - Intergenic
1159329878 18:66978582-66978604 TTATTTTATAAAGTGATTAAAGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165020559 19:32920825-32920847 TGAGGTCACCCAGTGATTCAGGG + Intronic
926042355 2:9683734-9683756 TTATGTTACAAAATCATGCATGG + Intergenic
930393227 2:50787634-50787656 CTAAGTTACCAAGTAATTTAAGG + Intronic
931931799 2:67146236-67146258 TCACATTACCAATTGATTCAGGG + Intergenic
934161759 2:89256357-89256379 TTTTGTAACAAAATGATTCACGG - Intergenic
934205523 2:89926005-89926027 TTTTGTAACAAAATGATTCACGG + Intergenic
934584537 2:95479166-95479188 TTACTTTCCCAAGTGACTCAGGG - Intergenic
934594915 2:95597549-95597571 TTACTTTCCCAAGTGACTCAGGG + Intronic
936986483 2:118315756-118315778 TTCTGTAACCAGGTGTTTCAGGG + Intergenic
937640858 2:124209498-124209520 TTATGTTTCCAAGTCACACAGGG - Intronic
938660101 2:133477759-133477781 TTAGGCTACTAAGTGACTCATGG + Intronic
938957945 2:136315824-136315846 TTATGTTAGGAAGTGATCCCAGG - Intergenic
939116539 2:138068000-138068022 TGATGTTACCAAGAAATTAAAGG - Intergenic
940824496 2:158395418-158395440 TCATGTTAACAAGTGAATGAAGG + Intronic
941259383 2:163277490-163277512 TTATTTTAATAAGTGATGCAAGG - Intergenic
942404363 2:175637698-175637720 GCATGTTACCACGTGATACAAGG + Intergenic
944427455 2:199598308-199598330 TTATGTGGCCAAGTGCTTTATGG - Intergenic
946919480 2:224563754-224563776 TTAAGTTACCAAGTTTTTAATGG - Intronic
1169972983 20:11290669-11290691 TTATATTATTAAGTGATTGAAGG - Intergenic
1174915131 20:54645687-54645709 TTATGTGGCCAATTGACTCATGG + Intronic
1179285217 21:39971971-39971993 TTGTGTCCCAAAGTGATTCAGGG + Intergenic
1182311206 22:29408944-29408966 TTATTTCACCAAGTGAATAAAGG + Intronic
1184306968 22:43610516-43610538 TGATGGTACCAAGTGCTACAGGG + Intronic
951545414 3:23820003-23820025 TTATGTTAACAAGTGAGCAAGGG + Intronic
953304911 3:41819947-41819969 TTATGTTACCTAGTAAGACAAGG + Intronic
954838094 3:53488672-53488694 TAATGTTACCAAATCATGCATGG + Intergenic
956033316 3:65062718-65062740 TTATTTTGCCAAGTCAGTCACGG - Intergenic
956974545 3:74564958-74564980 CTATGCTACCAAGTGAGCCATGG + Intergenic
957364393 3:79203558-79203580 TAATGTTCCCAAGTGAATCTTGG + Intronic
958039169 3:88206031-88206053 TCATGTTCTCAAGTGATCCATGG - Intergenic
959208803 3:103348917-103348939 CTATGATAGAAAGTGATTCAAGG + Intergenic
959307713 3:104690659-104690681 TTTTGTTGCAAACTGATTCATGG + Intergenic
960488997 3:118287271-118287293 TTATTTTATCAATAGATTCATGG - Intergenic
961907556 3:130278053-130278075 TTAGGCTACCAATTGAATCATGG - Intergenic
972634652 4:40872436-40872458 TCATGTTAGAAAGTGCTTCATGG + Intronic
972765368 4:42149081-42149103 TCATGTTACGAAATGAGTCAAGG - Intronic
973532424 4:51845925-51845947 TTATATTACCAAGAGTTTCCTGG - Intronic
973668147 4:53184167-53184189 TTATGTTACTAAATGATGTAAGG - Intronic
974243433 4:59282555-59282577 TTTTGTTACTAAGTGATTAGAGG + Intergenic
974407211 4:61489136-61489158 TTATTTTACCAGGTGGTTTAAGG - Intronic
974954773 4:68623983-68624005 TTATTATTCCAGGTGATTCATGG + Intronic
975202183 4:71604552-71604574 TTATGTTATATAGTGATTCTGGG + Intergenic
978203935 4:106057051-106057073 TGCTGTTACTATGTGATTCAAGG - Intronic
978503827 4:109435470-109435492 TCATGTTTACCAGTGATTCAAGG + Intronic
979094159 4:116523214-116523236 TTATGTTACAAAATCATGCATGG + Intergenic
979752943 4:124302134-124302156 TAATGTTTAGAAGTGATTCAGGG + Intergenic
979801518 4:124915030-124915052 TTATGCTACCATGTGATAAAGGG - Intergenic
979808592 4:125006437-125006459 TTTTTTTCCCAAGTGAGTCACGG + Intergenic
980647956 4:135669425-135669447 TTAAGTTAACAAGTGTTTTAGGG - Intergenic
984527984 4:180880241-180880263 TTATTTTTCCAAGTGTTTAAAGG + Intergenic
986550564 5:8949836-8949858 TTATGTTACCAAGTTATACTAGG - Intergenic
986618749 5:9647901-9647923 TAATGTTAACAAGCAATTCATGG + Intronic
986795457 5:11206786-11206808 TGATGTTATGAAGTTATTCAGGG - Intronic
987925771 5:24339529-24339551 TCATGTTAAAAAGTGTTTCATGG - Intergenic
988195053 5:27994101-27994123 TTTTGTTACTAAATGCTTCATGG - Intergenic
988310094 5:29545643-29545665 TTATGATACCAGGAAATTCAAGG + Intergenic
988313038 5:29586742-29586764 TCATTTGACCAAGTCATTCATGG + Intergenic
989327594 5:40217650-40217672 TATGGCTACCAAGTGATTCATGG + Intergenic
989753893 5:44927661-44927683 TTATGTCACTAAGGGATTCCAGG - Intergenic
990012517 5:51017575-51017597 TTTTGTTACCAAGTCATTTCAGG + Intergenic
993603241 5:89954850-89954872 TTAGGTTTCCAATTAATTCAAGG + Intergenic
994607810 5:101992508-101992530 TTATGCTATGAAGTCATTCATGG + Intergenic
996763084 5:127005461-127005483 TTATGTTACCACGTGATCCTGGG + Intronic
996805791 5:127452682-127452704 TAGTGTAACCAAGTGATTTATGG - Intronic
999845873 5:155479562-155479584 GGATGTTACCAAGCCATTCATGG - Intergenic
1005481565 6:26259876-26259898 TTATGTTACCTACTGCTTCTGGG + Intergenic
1005672908 6:28124964-28124986 TTCTGTTACCATGAGATGCACGG - Intronic
1005693479 6:28329529-28329551 TTTTGTTACCAAGAGACTCCTGG - Exonic
1005933822 6:30504284-30504306 TTATGATACAAAGTATTTCAGGG + Intergenic
1007054150 6:38865020-38865042 TTCAGTTACCATGTGATTAAGGG + Intronic
1008684600 6:53911248-53911270 ATATGTTCCCAAATGATTAATGG + Intronic
1011809613 6:91115449-91115471 TTATTTTTCCAAATGATTCATGG - Intergenic
1011890454 6:92152901-92152923 TTATGTTTCTAACTGACTCATGG - Intergenic
1011958911 6:93061374-93061396 TTATGTTATAAAGATATTCATGG + Intergenic
1012331388 6:97992999-97993021 TTATCTTACCTATTTATTCATGG - Intergenic
1013472766 6:110479288-110479310 TTCTCTCACCATGTGATTCAGGG + Intergenic
1013789802 6:113823951-113823973 TTGTGTTCCCAAGTCATTCAGGG - Intergenic
1014834330 6:126143765-126143787 TTATGTAACCAAGTGTTGCTTGG + Intergenic
1017422370 6:154285866-154285888 TTATGTTACCAAGTGATTCAAGG - Intronic
1021780958 7:24105467-24105489 TTATGTAACCACCTTATTCAAGG + Intergenic
1022487161 7:30788367-30788389 TTATGTTACTAAATCATTCAGGG - Intronic
1023899779 7:44466852-44466874 CTTTGTGACCTAGTGATTCATGG - Intronic
1025991482 7:66500641-66500663 TAATGTTATCCATTGATTCATGG - Intergenic
1027213747 7:76170499-76170521 TAATGTTATCCATTGATTCATGG - Intergenic
1027899951 7:84099894-84099916 ATATGTTTCAAAGTGAATCATGG + Intronic
1029903549 7:104067824-104067846 GTGTTATACCAAGTGATTCAGGG - Intergenic
1030415033 7:109232218-109232240 TTATGATACCAAGTAATTTCAGG - Intergenic
1031010195 7:116518499-116518521 TTTTGTTACCAACTGTTTAATGG + Intergenic
1031371244 7:120969513-120969535 TTATTTTGCCATGTGTTTCAAGG + Intronic
1032643521 7:133795729-133795751 TTATGTGACAAAGTTATTCAGGG + Intronic
1032858405 7:135856407-135856429 TTTTGTTACCTAGTTATACACGG + Intergenic
1033682950 7:143614180-143614202 TTATGTCACTAAGCGATTCATGG - Intergenic
1033701663 7:143843458-143843480 TTATGTCACTAAGCGATTCATGG + Intergenic
1037114692 8:15210318-15210340 TTATGATATGAAGTCATTCATGG + Intronic
1037527891 8:19745479-19745501 TAATCTTACCAAGTGTTTCCAGG + Intronic
1041463471 8:58136592-58136614 TTATATTTCCAAGTGATTCTTGG + Intronic
1046884021 8:119342655-119342677 TTATGTAACCACATGGTTCAGGG - Intergenic
1047884873 8:129238614-129238636 TAATGTTACCAAATGAAACAAGG - Intergenic
1051065520 9:13097744-13097766 TAATGTTTCAAAGTGATTCTTGG + Intergenic
1053127994 9:35598560-35598582 TTTTTTTCCCCAGTGATTCATGG - Intergenic
1055765555 9:79659428-79659450 TTATTTTACTAAGTGATTAAAGG - Intronic
1058320045 9:103617917-103617939 TTATGTAATCAAGTCGTTCATGG + Intergenic
1061689897 9:132318778-132318800 TTATGTTACCTTGTGGTGCAGGG - Intronic
1186613407 X:11161001-11161023 TTTTGTTACAGAGTGATTTAAGG + Intronic
1186892063 X:13968753-13968775 TTGTGTTACCAAGAGAATCCTGG + Intergenic
1188026220 X:25212348-25212370 CTATGATACCAAGTGTTGCAAGG - Intergenic
1188372084 X:29380749-29380771 TCATGTTACCAAGTGATACTCGG - Intronic
1188581347 X:31717835-31717857 TTCTGATAACAAGTGAATCAAGG + Intronic
1188600897 X:31962414-31962436 CCAAGTTTCCAAGTGATTCATGG - Intronic
1189285369 X:39848471-39848493 TTTTCTTCCCAAGTGATTGATGG - Intergenic
1190360280 X:49642873-49642895 TTATATTAAAAGGTGATTCAAGG - Intergenic
1194737190 X:97526489-97526511 TTTTGTTACCAAGTGCTAAATGG - Intronic
1197018324 X:121654988-121655010 GTATGTTAGCAAGTGAATTAAGG - Intergenic
1197297866 X:124741069-124741091 TTATCTTACCAAGTTATTTTAGG - Intronic
1197379228 X:125718552-125718574 TTAAATTTCCAAGTGTTTCATGG - Intergenic
1197466514 X:126810890-126810912 TTATGTTTTCAATTTATTCATGG + Intergenic
1198501744 X:137256451-137256473 TCATGTAGCCACGTGATTCAGGG - Intergenic
1199843685 X:151675462-151675484 TTATGTTGCAAAGTGATGCAAGG - Intronic
1201271035 Y:12253891-12253913 CTATGTTAACAAGTGATAAAGGG - Intergenic
1201383243 Y:13409682-13409704 TTATGCTAACAATTGATTTATGG + Intronic