ID: 1017431059

View in Genome Browser
Species Human (GRCh38)
Location 6:154371195-154371217
Sequence TTATCCTTCTTGGCAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017431059_1017431063 17 Left 1017431059 6:154371195-154371217 CCAGTAGCTGCCAAGAAGGATAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1017431063 6:154371235-154371257 TGTAAACTCACCACAGTCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 167
1017431059_1017431064 18 Left 1017431059 6:154371195-154371217 CCAGTAGCTGCCAAGAAGGATAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1017431064 6:154371236-154371258 GTAAACTCACCACAGTCCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 103
1017431059_1017431065 22 Left 1017431059 6:154371195-154371217 CCAGTAGCTGCCAAGAAGGATAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1017431065 6:154371240-154371262 ACTCACCACAGTCCAGGGGCAGG 0: 1
1: 0
2: 5
3: 17
4: 236
1017431059_1017431062 16 Left 1017431059 6:154371195-154371217 CCAGTAGCTGCCAAGAAGGATAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1017431062 6:154371234-154371256 GTGTAAACTCACCACAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017431059 Original CRISPR TTATCCTTCTTGGCAGCTAC TGG (reversed) Intronic
901679036 1:10902554-10902576 TTTGCCTTCATGGAAGCTACTGG - Intergenic
901869069 1:12126921-12126943 TTTTCCTTCCTGGAAGCTTCAGG + Intronic
902589806 1:17465684-17465706 TCTTGCTTTTTGGCAGCTACGGG + Intergenic
903860850 1:26363639-26363661 TTACCCTTCGTCCCAGCTACCGG + Intronic
904623156 1:31787627-31787649 TTGTCCTTCTTGGAAGCTGGAGG - Intergenic
906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG + Intergenic
906887268 1:49662975-49662997 TGATGCTTCTTGGCACATACTGG + Intronic
910596733 1:88989263-88989285 TTATCCTTCTTGTATACTACTGG - Intronic
911439401 1:97906779-97906801 TTTTCCTTCTTCACAGCTTCAGG + Intronic
914354725 1:146874746-146874768 TTCTCCTTCTTGTCATCTCCTGG + Intergenic
921820985 1:219617056-219617078 TTATCTTCCTTGGAAACTACAGG + Intergenic
922044415 1:221929293-221929315 TTATCCTCCCTGCCAGCTCCAGG + Intergenic
1063590102 10:7387404-7387426 TTGTCCTTGCTGGCAGCCACTGG - Intronic
1068824160 10:61414554-61414576 TTATCTGTCTTGGCAGTTAATGG + Intronic
1069118918 10:64544034-64544056 TTCCCCTTCTTCCCAGCTACTGG - Intergenic
1069258978 10:66370278-66370300 TTAGCTGTCTTTGCAGCTACAGG + Intronic
1070195451 10:74151926-74151948 TTACACTTTTTGGCAGCAACGGG + Intronic
1072776082 10:98195742-98195764 TTATTTTTCTTGGCCACTACAGG - Intronic
1073525868 10:104181408-104181430 TGATCCTTCTTATCACCTACAGG + Intronic
1073679629 10:105688620-105688642 TATTCCCTCTTGGCAGCTAATGG + Intergenic
1074218434 10:111410930-111410952 TTATCCAGTTTGTCAGCTACCGG - Intergenic
1078304529 11:10171071-10171093 TTATCCTTCTTTGCAGATGATGG - Intronic
1081068748 11:38582380-38582402 TAATCCTACTTGGCAGCAAAAGG + Intergenic
1085661729 11:78373883-78373905 TTATCCTTCTTTGCTGCTCCAGG + Intronic
1092056793 12:5514075-5514097 TGTTCCTTCATGGCAGCTACAGG - Intronic
1093396780 12:18692793-18692815 TCATCCTTCTTGCCACCTCCAGG - Intronic
1094223004 12:28014431-28014453 TTCTCCTTGATGGCAGCAACTGG + Intergenic
1099716772 12:86304866-86304888 TCTTCCTTCTTCCCAGCTACTGG - Intronic
1100182294 12:92098790-92098812 TTAACCTGCTTGGCAGCTCTAGG + Intronic
1100883145 12:99040376-99040398 TTCTTCTTCGTGGCAGCCACTGG - Intronic
1105410865 13:20170043-20170065 TTTTCTTTCTTGGCTTCTACTGG + Intergenic
1108120084 13:47176102-47176124 ATAGCCTTATTGGCAGCTAGGGG - Intergenic
1109714805 13:66207376-66207398 TTCACCTTCTTTGCAGCTATGGG + Intergenic
1110481418 13:75982069-75982091 TTATTCTTTTTGGCAGCTGCAGG - Intergenic
1112690307 13:101885752-101885774 TTGTCCTTCTTTGCAGCTCCAGG - Intronic
1120977187 14:90259187-90259209 TCATCCTTCTTGCCACCTCCAGG - Exonic
1121612453 14:95291017-95291039 ATATCCTTCTAGGCACCTGCTGG + Intronic
1125000770 15:34767949-34767971 TTATACATCTTGACAACTACTGG + Intergenic
1134011048 16:10853385-10853407 TCATCCTCCGTGGCAGCTACAGG - Intergenic
1138353045 16:56356661-56356683 GTGTTCTTTTTGGCAGCTACTGG - Intronic
1138521084 16:57571191-57571213 TTTTCCTTCTTGGCTGATGCAGG + Intronic
1139979296 16:70840786-70840808 TTCTCCTTCTTGTCATCTCCTGG - Intronic
1149853399 17:60055595-60055617 TTCTTTTTCTTGGCAGCTTCTGG - Exonic
1152794816 17:82301710-82301732 ATGTCCTTCCTGGCAGCTATGGG + Intergenic
1157617753 18:48997356-48997378 TTCCCCTTCTTGCCAGCTCCAGG + Intergenic
1159262857 18:66038267-66038289 GTATACTTCTTGGCAGCAATAGG + Intergenic
1162865488 19:13542940-13542962 TTATTTTTCTTGCCAGCTCCAGG - Intronic
1165317815 19:35067212-35067234 TTCTCCATCTGGGCAGCTTCTGG + Intergenic
1166209358 19:41296306-41296328 TCAGCCTTCTTGGCTGCTGCTGG + Intronic
1166689974 19:44816528-44816550 TCATCCTTCTTAGCAGCTGGTGG + Intronic
928210791 2:29322179-29322201 TCAGCCTTCTTGGCAGCAGCAGG + Intronic
929620138 2:43346409-43346431 TTGCCCTTCTTGGGAGCTGCCGG - Intronic
929651193 2:43681359-43681381 ATTTACTTCTTGGCTGCTACTGG + Intronic
930342331 2:50132735-50132757 TTTTCCTTCCAGGAAGCTACTGG - Intronic
931982021 2:67703784-67703806 TTTTCCTTATTGGAAGCTAGTGG + Intergenic
935109658 2:100080873-100080895 TGATCCTGATTGCCAGCTACTGG - Intronic
935470274 2:103451301-103451323 TAATTCCTCTTGGGAGCTACAGG - Intergenic
936125316 2:109784336-109784358 TGATCCTGATTGCCAGCTACTGG + Intergenic
936219377 2:110587132-110587154 TGATCCTGATTGCCAGCTACTGG - Intergenic
936229283 2:110685752-110685774 TCCTCCCTCTTGTCAGCTACAGG + Intergenic
936853166 2:116925976-116925998 TTAACATTATTGGCAGTTACAGG - Intergenic
937122699 2:119451895-119451917 TTATCCCTCCTGGCACCTGCAGG + Intronic
937843928 2:126556314-126556336 TATTCCCTCTTGGCAGCTAATGG - Intergenic
938323247 2:130379879-130379901 TTATCCTTCTTCACATCCACTGG - Intergenic
939388949 2:141541360-141541382 TCATCTTACTTGACAGCTACAGG - Intronic
941153603 2:161946947-161946969 TCATCTTTCTTGGCAGCTTTTGG + Intronic
943682643 2:190784574-190784596 CTATCCTTCTTTGCAGCTAGTGG + Intergenic
948899612 2:240949723-240949745 GTAGCCTTCTAGGAAGCTACTGG - Intronic
1168803789 20:661449-661471 TGACCCTTGGTGGCAGCTACAGG + Intronic
1174923445 20:54730183-54730205 TTATCCTTCTTGCAAGCCATTGG + Intergenic
1178925840 21:36774257-36774279 ATATTATTCCTGGCAGCTACAGG + Intronic
1182195704 22:28514572-28514594 TGTTCACTCTTGGCAGCTACTGG + Intronic
949518444 3:4827944-4827966 TTATCCGTCTCGCCATCTACAGG - Intronic
950587161 3:13902014-13902036 TTATCTGTTTTGGCAGCTATAGG - Intergenic
952324720 3:32310643-32310665 TTATCCTTATGGTCAGCTATGGG + Intronic
952994452 3:38865444-38865466 TTAGCCTTCTTAGCATCTGCTGG - Intronic
956377945 3:68635735-68635757 TCATCCTTCTTGCCACCTCCAGG - Intergenic
960673646 3:120174990-120175012 CCATCCTACTTGGGAGCTACTGG + Intronic
963850480 3:150206095-150206117 TCATCCTTCTTGTCAGCTCCTGG - Intergenic
966704526 3:182896221-182896243 TTATCCTTCCTTTCAGATACAGG + Intronic
969597162 4:8156091-8156113 ATATCCTCCTGGGCAGCTGCTGG - Intronic
971220411 4:24700503-24700525 CTTTCCATCTTAGCAGCTACAGG - Intergenic
973343567 4:49030588-49030610 TTATCCTTCTTGGTAGTTCCTGG + Intronic
974452627 4:62086516-62086538 TTATCCTTCTTTGCTGCTGTTGG - Intergenic
976350825 4:84057794-84057816 TGATGCTTCTTTGGAGCTACTGG + Intergenic
976525976 4:86089183-86089205 GTATCCTTCTTAGCAGCCAGTGG - Intronic
979931728 4:126640469-126640491 TTTTCCTTCTTGGCAGAAAGAGG + Intergenic
992411709 5:76511507-76511529 TTAACTTTCTTCACAGCTACAGG - Intronic
993031175 5:82707465-82707487 TCAACATTCTTGGCAGCTAGGGG + Intergenic
993677684 5:90836933-90836955 TTCTCATTCATGCCAGCTACTGG - Intronic
994512115 5:100717608-100717630 TCAACTTTGTTGGCAGCTACAGG + Intergenic
994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG + Intergenic
996934168 5:128928982-128929004 TTATCCTTCTTGCTGGCTACGGG - Intronic
997767578 5:136520205-136520227 GTATCCTTCATGGCACATACTGG - Intergenic
998027105 5:138827371-138827393 TTATACTTCTTAGCAGGTAAGGG - Intronic
1000529363 5:162400137-162400159 TTTTCCTTCTTGGCAGCCCCTGG - Intergenic
1002556687 5:180047294-180047316 TTATTTTTAATGGCAGCTACTGG + Intronic
1003171030 6:3722345-3722367 TTTTTCTTTTTGGCAGCCACAGG - Intergenic
1003282036 6:4702493-4702515 TCATCCTTCTTGCCACCTCCAGG - Intergenic
1003436032 6:6089160-6089182 CTATCCATTTTGGTAGCTACTGG + Intergenic
1005114079 6:22317224-22317246 TTTTCCTTCTGGGCAGTTTCTGG + Intergenic
1005455681 6:26017659-26017681 TTTGCCTTCTTGCCAGCTAAAGG + Exonic
1013498765 6:110726075-110726097 TTATTGTTCTTTGAAGCTACTGG - Intronic
1014933173 6:127357896-127357918 TATTCCTTCTTGGCAGCTAATGG + Intergenic
1015416932 6:132959999-132960021 TTATGCTACTTTGCAGCTTCAGG + Intergenic
1016136357 6:140548566-140548588 TTATCCTTCCTGGCCTCTTCTGG - Intergenic
1017431059 6:154371195-154371217 TTATCCTTCTTGGCAGCTACTGG - Intronic
1017557402 6:155586591-155586613 TAATCTTGCTTGGCAGATACTGG - Intergenic
1019730725 7:2627941-2627963 TTACCCTTCCTGGCAGCTGGAGG + Intergenic
1024957262 7:54935968-54935990 ATGTCCTTCTTGGCAGAAACTGG - Intergenic
1030986628 7:116249195-116249217 ACATTCTTCTTGGCAGCAACTGG - Exonic
1031284530 7:119847891-119847913 TTTTCCTTCTTGGCAGACAATGG - Intergenic
1032843713 7:135735223-135735245 TGATTCTTCTTGGCAGCTCTTGG + Intronic
1033222415 7:139537138-139537160 TTTTCCTTCTGGGAAGCCACTGG - Intronic
1037873777 8:22526157-22526179 TTAGACTTCTTGGTATCTACAGG + Intronic
1038409324 8:27345825-27345847 GTTTCCTCCATGGCAGCTACTGG - Intronic
1039322015 8:36442616-36442638 TTATCCTGCTTGGGATATACTGG + Intergenic
1043295585 8:78658493-78658515 TTATGTTTCTTAGCAGCTAATGG - Intergenic
1044978189 8:97687581-97687603 TTATTCTTCTTGGAACCAACAGG - Exonic
1045302022 8:100919582-100919604 TATTCCCTCTTGGCAGCTAATGG - Exonic
1045372508 8:101538877-101538899 TTCACATTCTTGGCAGCCACAGG - Intronic
1045420840 8:102013488-102013510 TCATCCTCCTTTGCAGCTAAGGG + Intronic
1045856000 8:106766401-106766423 GTCTCCTTATTGGCAGATACAGG + Intronic
1046095315 8:109552159-109552181 CTATCCTTCCTTGCAGCTAGGGG - Intronic
1048253513 8:132886975-132886997 CCATCCTTCTTAGCAGCTTCAGG - Exonic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1056918853 9:90768472-90768494 CTTTCCTTATTGGCTGCTACAGG - Intergenic
1057081128 9:92175475-92175497 TTCTCCTTTGTGGCAGCCACAGG - Intergenic
1058604298 9:106704357-106704379 TTATGGTTCTTTGCAGCTAGGGG - Intergenic
1062211316 9:135365818-135365840 TTATCGCTCATGGCAGCAACAGG - Intergenic
1186284946 X:8033203-8033225 TTATCCTTCTGGGTAACTAGAGG + Intergenic
1187899135 X:24010975-24010997 TTTTCCTTCTTGGCAACTGAGGG - Intronic
1188767933 X:34119674-34119696 TTATACTTCTAGGAAGATACTGG + Intergenic
1189512275 X:41674708-41674730 TATTCCCTCTTGGCAGCTAATGG - Intronic
1192744273 X:73923171-73923193 TTTTCCTTTTTGCCAGCTTCTGG - Intergenic
1193040745 X:77001182-77001204 TAATCCTTCATGGGAGCTAAGGG + Intergenic
1198210212 X:134509157-134509179 TTATCCTTCCTATCAGCTTCAGG + Intronic
1201266329 Y:12210704-12210726 TGTTCCTCCTTGGAAGCTACTGG + Intergenic