ID: 1017432027

View in Genome Browser
Species Human (GRCh38)
Location 6:154380995-154381017
Sequence GTGATAGGGCTCCCTAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017432027_1017432032 -2 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432032 6:154381016-154381038 ACACTGGCCCTGTTATGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1017432027_1017432031 -3 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432031 6:154381015-154381037 CACACTGGCCCTGTTATGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 97
1017432027_1017432035 16 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432035 6:154381034-154381056 TCGGGTTCCTCTCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017432027 Original CRISPR GTGATAGGGCTCCCTAACTG AGG (reversed) Intronic
900750625 1:4394832-4394854 GAGCTAGGGATCTCTAACTGGGG + Intergenic
908140430 1:61178914-61178936 GAGATTGGGCTCCCTGCCTGTGG + Intronic
908846300 1:68327957-68327979 CTGAAAGGGCTTCCTAACTCAGG + Intergenic
920258401 1:204672360-204672382 AAGATAGGGCTCCCCAAGTGGGG + Intronic
1065652206 10:27904190-27904212 GTGATAGGGCTCCTGCAATGTGG + Intronic
1067232706 10:44423361-44423383 GAGTTAGGGTACCCTAACTGTGG + Intergenic
1073997010 10:109326997-109327019 GTGATAGAGCTCACTTACAGTGG - Intergenic
1079608671 11:22403087-22403109 GATAGAGGGCTCACTAACTGAGG + Intergenic
1083656806 11:64234024-64234046 GGGATAGGGATCCCGAAGTGTGG - Intronic
1086854927 11:91854750-91854772 GAGCTAGGGCCACCTAACTGTGG + Intergenic
1090611619 11:128476178-128476200 GTGATAGGACTCCTTATCTGTGG + Intronic
1092954481 12:13537136-13537158 TGGATAGGTTTCCCTAACTGAGG + Intergenic
1098350011 12:69548839-69548861 GTGAGAGAGCTGCCTAACAGGGG + Intronic
1103588116 12:121971208-121971230 CTGAGAGGGCTCCCTCTCTGTGG - Intronic
1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG + Intergenic
1109305952 13:60641879-60641901 GTGATAACCCTCCCTACCTGGGG + Intergenic
1115894413 14:38069415-38069437 CTGATAGTGCTCCCTAACCATGG - Intergenic
1116964473 14:50999983-51000005 GGGATAGGGCTCCCTCACCTTGG + Intronic
1131366305 15:91845019-91845041 GTCACAGGGCTCCCTCTCTGAGG + Intergenic
1133312606 16:4859819-4859841 GTTACACGGCTCCCTAACTCAGG - Intronic
1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG + Intronic
1139287059 16:65825194-65825216 GTGATTAGGCTCCGTATCTGAGG - Intergenic
1139581785 16:67878168-67878190 GAGAGAGGGCTCCTTCACTGAGG - Exonic
1150065655 17:62106837-62106859 GTGACAGGGCTCCCTGCTTGTGG - Intergenic
1158767057 18:60464307-60464329 GTGATAGTGATTCCTAACTGGGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
931249491 2:60517331-60517353 CTGCTAGGGCTCCCAAAGTGTGG - Intronic
943675925 2:190716469-190716491 GAGATAGGGGTGCTTAACTGGGG + Intergenic
1168863041 20:1059861-1059883 AGGACAGGTCTCCCTAACTGTGG - Intergenic
1175849362 20:62080406-62080428 GTGAGAGAGCTCACTCACTGCGG + Intergenic
1177734789 21:25075490-25075512 GTGAAAGGACTCCCTAAATAGGG + Intergenic
954631813 3:52051868-52051890 GTGATGGGGCTTCATAAGTGAGG + Intronic
958592115 3:96171229-96171251 TTGATAGGGCTCCATAGCTTGGG + Intergenic
960435816 3:117625393-117625415 ATGAAAGAGCTCCCTAATTGAGG - Intergenic
962915827 3:139902578-139902600 GTGAGAGGACTTCCTAAATGAGG - Intergenic
964037205 3:152213979-152214001 GTGAAATTGCTCACTAACTGGGG + Intergenic
967438384 3:189477796-189477818 GTGCTAGGGATCCCTCTCTGCGG - Intergenic
986338263 5:6770413-6770435 GTGACAGGGATCCCTCCCTGAGG + Intergenic
997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG + Intergenic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1001928022 5:175653187-175653209 GTGGTAGGGCACCTGAACTGTGG - Intergenic
1003322442 6:5063717-5063739 GGGAGATGGCTCCCCAACTGTGG - Intergenic
1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG + Exonic
1007637035 6:43305875-43305897 GTGATAGGGCTCTCTCTCTCAGG - Exonic
1017069982 6:150567481-150567503 ATGATAGGGCTTCCACACTGAGG - Intergenic
1017432027 6:154380995-154381017 GTGATAGGGCTCCCTAACTGAGG - Intronic
1029303648 7:99603087-99603109 GTGATAGGGATCCTTCACTGAGG + Intronic
1030097840 7:105916911-105916933 GTGATAGGGCTGGCTAATTAGGG + Intronic
1030745203 7:113157003-113157025 GTGATGGGGCTCCTTGGCTGTGG + Intergenic
1052363867 9:27589600-27589622 ATGTAACGGCTCCCTAACTGTGG - Intergenic
1053031278 9:34780899-34780921 GTGAAAGGGGTACCTTACTGTGG - Intergenic
1054744730 9:68843192-68843214 GGCATAGGGTTCCCTGACTGGGG - Intronic
1055213211 9:73824079-73824101 GTGACAGGGCTCACTATCTGAGG + Intergenic
1062465364 9:136678438-136678460 GTGATGGGGTGCCCTATCTGGGG - Intronic
1191910539 X:66144591-66144613 GTGAAAGGGCTCCCTGGCAGAGG + Intergenic
1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG + Intergenic
1198280675 X:135138861-135138883 GTGATAGGGATCCCTCACTGGGG + Intergenic
1198290284 X:135233653-135233675 GTGATAGGGATCCCTCACTGGGG - Intergenic
1200229291 X:154436250-154436272 GTTATAGGGCTCCCTGAGTTTGG + Exonic