ID: 1017432027

View in Genome Browser
Species Human (GRCh38)
Location 6:154380995-154381017
Sequence GTGATAGGGCTCCCTAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017432027_1017432032 -2 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432032 6:154381016-154381038 ACACTGGCCCTGTTATGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1017432027_1017432031 -3 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432031 6:154381015-154381037 CACACTGGCCCTGTTATGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 97
1017432027_1017432035 16 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432035 6:154381034-154381056 TCGGGTTCCTCTCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017432027 Original CRISPR GTGATAGGGCTCCCTAACTG AGG (reversed) Intronic