ID: 1017432031

View in Genome Browser
Species Human (GRCh38)
Location 6:154381015-154381037
Sequence CACACTGGCCCTGTTATGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017432027_1017432031 -3 Left 1017432027 6:154380995-154381017 CCTCAGTTAGGGAGCCCTATCAC 0: 1
1: 0
2: 2
3: 4
4: 52
Right 1017432031 6:154381015-154381037 CACACTGGCCCTGTTATGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 97
1017432026_1017432031 -2 Left 1017432026 6:154380994-154381016 CCCTCAGTTAGGGAGCCCTATCA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1017432031 6:154381015-154381037 CACACTGGCCCTGTTATGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 97
1017432025_1017432031 4 Left 1017432025 6:154380988-154381010 CCTTTACCCTCAGTTAGGGAGCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1017432031 6:154381015-154381037 CACACTGGCCCTGTTATGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017432031 Original CRISPR CACACTGGCCCTGTTATGTT CGG Intronic